ID: 1121571844

View in Genome Browser
Species Human (GRCh38)
Location 14:94952109-94952131
Sequence CTGAGCAAGGCCAGGGCGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121571827_1121571844 24 Left 1121571827 14:94952062-94952084 CCTATACCCACACCCCGAGGGCC No data
Right 1121571844 14:94952109-94952131 CTGAGCAAGGCCAGGGCGGAGGG No data
1121571832_1121571844 17 Left 1121571832 14:94952069-94952091 CCACACCCCGAGGGCCGGGGCAG No data
Right 1121571844 14:94952109-94952131 CTGAGCAAGGCCAGGGCGGAGGG No data
1121571833_1121571844 12 Left 1121571833 14:94952074-94952096 CCCCGAGGGCCGGGGCAGACAGA No data
Right 1121571844 14:94952109-94952131 CTGAGCAAGGCCAGGGCGGAGGG No data
1121571831_1121571844 18 Left 1121571831 14:94952068-94952090 CCCACACCCCGAGGGCCGGGGCA No data
Right 1121571844 14:94952109-94952131 CTGAGCAAGGCCAGGGCGGAGGG No data
1121571836_1121571844 3 Left 1121571836 14:94952083-94952105 CCGGGGCAGACAGAAGCCTGCCA No data
Right 1121571844 14:94952109-94952131 CTGAGCAAGGCCAGGGCGGAGGG No data
1121571835_1121571844 10 Left 1121571835 14:94952076-94952098 CCGAGGGCCGGGGCAGACAGAAG No data
Right 1121571844 14:94952109-94952131 CTGAGCAAGGCCAGGGCGGAGGG No data
1121571834_1121571844 11 Left 1121571834 14:94952075-94952097 CCCGAGGGCCGGGGCAGACAGAA No data
Right 1121571844 14:94952109-94952131 CTGAGCAAGGCCAGGGCGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121571844 Original CRISPR CTGAGCAAGGCCAGGGCGGA GGG Intergenic
No off target data available for this crispr