ID: 1121573254 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 14:94963247-94963269 |
| Sequence | CCCATCTTCCTCTAAGACCA TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1121573254_1121573258 | -8 | Left | 1121573254 | 14:94963247-94963269 | CCATGGTCTTAGAGGAAGATGGG | No data | ||
| Right | 1121573258 | 14:94963262-94963284 | AAGATGGGGGCGCTAAGAGATGG | No data | ||||
| 1121573254_1121573260 | 22 | Left | 1121573254 | 14:94963247-94963269 | CCATGGTCTTAGAGGAAGATGGG | No data | ||
| Right | 1121573260 | 14:94963292-94963314 | ATCCTATGCTGAAAGTGTTTGGG | No data | ||||
| 1121573254_1121573259 | 21 | Left | 1121573254 | 14:94963247-94963269 | CCATGGTCTTAGAGGAAGATGGG | No data | ||
| Right | 1121573259 | 14:94963291-94963313 | CATCCTATGCTGAAAGTGTTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1121573254 | Original CRISPR | CCCATCTTCCTCTAAGACCA TGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||