ID: 1121573254

View in Genome Browser
Species Human (GRCh38)
Location 14:94963247-94963269
Sequence CCCATCTTCCTCTAAGACCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121573254_1121573258 -8 Left 1121573254 14:94963247-94963269 CCATGGTCTTAGAGGAAGATGGG No data
Right 1121573258 14:94963262-94963284 AAGATGGGGGCGCTAAGAGATGG No data
1121573254_1121573260 22 Left 1121573254 14:94963247-94963269 CCATGGTCTTAGAGGAAGATGGG No data
Right 1121573260 14:94963292-94963314 ATCCTATGCTGAAAGTGTTTGGG No data
1121573254_1121573259 21 Left 1121573254 14:94963247-94963269 CCATGGTCTTAGAGGAAGATGGG No data
Right 1121573259 14:94963291-94963313 CATCCTATGCTGAAAGTGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121573254 Original CRISPR CCCATCTTCCTCTAAGACCA TGG (reversed) Intergenic
No off target data available for this crispr