ID: 1121573259

View in Genome Browser
Species Human (GRCh38)
Location 14:94963291-94963313
Sequence CATCCTATGCTGAAAGTGTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121573254_1121573259 21 Left 1121573254 14:94963247-94963269 CCATGGTCTTAGAGGAAGATGGG No data
Right 1121573259 14:94963291-94963313 CATCCTATGCTGAAAGTGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121573259 Original CRISPR CATCCTATGCTGAAAGTGTT TGG Intergenic
No off target data available for this crispr