ID: 1121573934

View in Genome Browser
Species Human (GRCh38)
Location 14:94967880-94967902
Sequence GCCCCCAACCAAGTAACTTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121573930_1121573934 2 Left 1121573930 14:94967855-94967877 CCTTGAGATGCTCTGCCTCAAAG No data
Right 1121573934 14:94967880-94967902 GCCCCCAACCAAGTAACTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121573934 Original CRISPR GCCCCCAACCAAGTAACTTT GGG Intergenic
No off target data available for this crispr