ID: 1121576681

View in Genome Browser
Species Human (GRCh38)
Location 14:94994650-94994672
Sequence CATTTCCATTAGAGGGCAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121576675_1121576681 28 Left 1121576675 14:94994599-94994621 CCAGCTAGGTCTGTGTCTTCTTC No data
Right 1121576681 14:94994650-94994672 CATTTCCATTAGAGGGCAGTAGG No data
1121576674_1121576681 29 Left 1121576674 14:94994598-94994620 CCCAGCTAGGTCTGTGTCTTCTT No data
Right 1121576681 14:94994650-94994672 CATTTCCATTAGAGGGCAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121576681 Original CRISPR CATTTCCATTAGAGGGCAGT AGG Intergenic
No off target data available for this crispr