ID: 1121576844

View in Genome Browser
Species Human (GRCh38)
Location 14:94995754-94995776
Sequence CATCTTCCGCTGCCAAGGAT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121576840_1121576844 10 Left 1121576840 14:94995721-94995743 CCTGCGGGGACAGGAGTCAAGGG No data
Right 1121576844 14:94995754-94995776 CATCTTCCGCTGCCAAGGATCGG No data
1121576838_1121576844 11 Left 1121576838 14:94995720-94995742 CCCTGCGGGGACAGGAGTCAAGG No data
Right 1121576844 14:94995754-94995776 CATCTTCCGCTGCCAAGGATCGG No data
1121576833_1121576844 26 Left 1121576833 14:94995705-94995727 CCGGAAGCAACTGGACCCTGCGG No data
Right 1121576844 14:94995754-94995776 CATCTTCCGCTGCCAAGGATCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121576844 Original CRISPR CATCTTCCGCTGCCAAGGAT CGG Intergenic
No off target data available for this crispr