ID: 1121589489

View in Genome Browser
Species Human (GRCh38)
Location 14:95091871-95091893
Sequence ATCTAGTGGCTTAATGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 139}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121589489 Original CRISPR ATCTAGTGGCTTAATGAAGA GGG (reversed) Intronic
901097044 1:6690051-6690073 ATCAAGTGACTTATTGAAGATGG + Intronic
906247384 1:44286261-44286283 TTCTAGTGGCGTACTAAAGATGG - Intronic
906918049 1:50032816-50032838 ATCTAGGGACTTAGTGAACATGG + Intergenic
906979070 1:50608606-50608628 AAGTAGTGTCTTACTGAAGAAGG + Intronic
910955356 1:92697357-92697379 ATCTAGTGACTGTATGAAGGTGG - Intronic
918284951 1:183043180-183043202 ATCTAGTAGATTTAGGAAGATGG + Intronic
921556475 1:216604279-216604301 ATCTAGAAGCTCAGTGAAGAGGG + Intronic
1062979156 10:1707525-1707547 ATCTTGTTACTTGATGAAGATGG + Intronic
1063587454 10:7365395-7365417 ATCGAGTGATTTACTGAAGAAGG - Intronic
1066193942 10:33080445-33080467 ATCTGATGGCTTTATGAAGGGGG + Intergenic
1066361366 10:34734819-34734841 ATCTAGTGTCTTGCTTAAGAAGG - Intronic
1067862757 10:49870051-49870073 ATCTAGTTGTTTAATTAACAAGG - Intronic
1068244173 10:54342539-54342561 ATCTACTAGCATAATGCAGAGGG + Intronic
1068829696 10:61479337-61479359 ATTCAGAGGCTTAATGATGAAGG - Intergenic
1070211120 10:74323424-74323446 ATAAAGTTGCTTAAAGAAGAAGG - Intronic
1072829954 10:98647211-98647233 ATCTAGGGGCCTGATGAAGGGGG - Intronic
1073960195 10:108917845-108917867 ACATAGTTGCTTAGTGAAGAAGG + Intergenic
1075264399 10:120988468-120988490 AGCTTGTGGCTAAATGAATATGG - Intergenic
1075545887 10:123354291-123354313 CTCTAGTGGCTTAACTAAGCTGG + Intergenic
1076063611 10:127431287-127431309 TTCTAGAGGCTCAATCAAGAAGG + Intronic
1085267620 11:75246607-75246629 AGGCAGCGGCTTAATGAAGAAGG - Intergenic
1087104761 11:94398377-94398399 ATTGAGTGGCTCAATGAAGCTGG - Intronic
1087466157 11:98509238-98509260 AATTAGTGTCTTAATGAACAGGG + Intergenic
1087570349 11:99919432-99919454 ATGTAGTAGCTGAATGAAGAGGG - Intronic
1088915641 11:114225789-114225811 ATCCAGTGGCTGGGTGAAGAAGG - Intronic
1089951635 11:122533904-122533926 ATCAAGTGGCTTAAGCAAGATGG + Intergenic
1090980394 11:131715147-131715169 ATATGGTGGCTTAAACAAGATGG + Intronic
1091673764 12:2472388-2472410 ATGAATAGGCTTAATGAAGATGG - Intronic
1091970935 12:4786375-4786397 AATTAGTACCTTAATGAAGATGG - Intronic
1093756732 12:22861160-22861182 ATCTAATGGGTTAATGAGGCTGG - Intergenic
1101010116 12:100440779-100440801 AACAAATGGATTAATGAAGAAGG - Intergenic
1102012880 12:109629585-109629607 ATCTATTGGCTTCCTGGAGATGG + Intergenic
1103776342 12:123369252-123369274 ATCTATTGGATTATTCAAGATGG + Intergenic
1110798240 13:79665175-79665197 ACCTAATGGCATAATGATGATGG + Intergenic
1111119398 13:83825206-83825228 CTCTAATGACTTAATTAAGATGG - Intergenic
1112543082 13:100336492-100336514 AATTAGTGGCTTAATGAACAAGG + Intronic
1114529256 14:23385400-23385422 ATGTAGTGGGGTAAGGAAGAGGG + Intronic
1119142333 14:72278692-72278714 AGACAATGGCTTAATGAAGATGG - Intronic
1120042148 14:79766305-79766327 ATCTAGTGGCTGAAGTAATATGG + Intronic
1120075122 14:80147446-80147468 TTCTAGTGACTAAATGATGATGG + Intergenic
1121589489 14:95091871-95091893 ATCTAGTGGCTTAATGAAGAGGG - Intronic
1125409973 15:39395870-39395892 AGCTAGTGGCTAAAGGAACATGG - Intergenic
1126588782 15:50318485-50318507 ATCTAGTGGTTTTCTGAAAAAGG - Intronic
1126789857 15:52211203-52211225 ATACAGTGTCTTAAAGAAGATGG - Intronic
1128849128 15:70933758-70933780 ATGCAGGGGCTTAATGAAAATGG + Intronic
1131203522 15:90421590-90421612 ATGGAGTGTCATAATGAAGAAGG + Intronic
1133483189 16:6191992-6192014 ATCTAGTAGATTGAGGAAGAAGG + Intronic
1134691709 16:16195038-16195060 ACCTAGTGGCTCAATGGAGAAGG + Intronic
1137092017 16:36204674-36204696 TTCCAGTGCCTTAATGATGAAGG - Intergenic
1137539395 16:49351704-49351726 ATCTGATGGGCTAATGAAGATGG + Intergenic
1144356389 17:14450748-14450770 TTCTGGTGGCTGAATGAAAAAGG + Intergenic
1148721283 17:49755062-49755084 GTCTGGTGGCTTAGTGAAAATGG - Intronic
1151041733 17:70869590-70869612 ATATTGTGGATTAATTAAGATGG + Intergenic
1151090581 17:71435506-71435528 ATTTAGTGGATTAAAGAAAATGG - Intergenic
1155083942 18:22437740-22437762 TTTTAGTGTCTTAATTAAGAAGG + Intergenic
1156810887 18:41249973-41249995 ATCTAGTTGCTTAAGGTGGATGG + Intergenic
1157997357 18:52574475-52574497 ATCTAACAGCTTTATGAAGAAGG - Intronic
1158814149 18:61074281-61074303 ATTTAGTGGCTTCAAGAAGAAGG + Intergenic
1159457663 18:68681841-68681863 AGCTAGTCTCTAAATGAAGATGG - Intronic
1160224613 18:77002417-77002439 ATCCAGTGGCTAAATGCAGTAGG + Intronic
1161879652 19:6939387-6939409 ATCCAGTGGCTTAATTAAATAGG + Intronic
1165414279 19:35682399-35682421 ATCCTGTGTCTTTATGAAGAAGG - Intergenic
925261378 2:2531384-2531406 ATCTATTGGCTTAAGGAATAAGG + Intergenic
929269653 2:39959527-39959549 ATCTAGCGGCTTCAGGATGATGG + Intergenic
930165637 2:48201232-48201254 GTCTAGTTGCTCAATTAAGATGG - Intergenic
931619322 2:64193931-64193953 ATCTGCTGGCTGAATGCAGATGG + Intergenic
935815701 2:106843998-106844020 ACCTTGTGTCTTAATGCAGATGG + Exonic
935914470 2:107934753-107934775 AACTAGTGGCTTACTGACCAGGG + Intergenic
936762057 2:115798914-115798936 AGATAGTGGATTAATGAAGAAGG - Intronic
940794957 2:158068104-158068126 ATTTAGTTACTTAATGAAAATGG + Intronic
942238573 2:173937342-173937364 ATCTCTTGTGTTAATGAAGAAGG - Intronic
942585851 2:177476242-177476264 TTCTAGTAGCTTAAGGTAGAAGG + Intronic
942716032 2:178893170-178893192 CTCTATTGGCTCAATGAATAAGG - Intronic
944554694 2:200876020-200876042 AAATAGTGGCTTAAACAAGATGG - Intronic
946759098 2:222975383-222975405 ATTTGGTGGCTAAATGAAGATGG + Intergenic
947173833 2:227339722-227339744 ATCCTGTCTCTTAATGAAGAAGG + Intronic
1169591433 20:7147141-7147163 TTCTAGTGGTTTAATTAAGAAGG - Intergenic
1169780043 20:9299964-9299986 ATTTAATGGCTTAATAAAAATGG + Intronic
1177266404 21:18790256-18790278 ATGTATTCTCTTAATGAAGATGG - Intergenic
1178522020 21:33294513-33294535 ATCCAGTGGATTAATGAGAATGG - Intronic
1184199606 22:42958334-42958356 ATTTGGTGGCATAATGCAGAAGG - Intronic
951243247 3:20311734-20311756 AACTAGTGGCATAATAAAAAGGG - Intergenic
952328267 3:32340283-32340305 CTCTAGTGGATAAGTGAAGATGG + Intronic
952780323 3:37090749-37090771 ATCTAGTGCCTTAAAGAATTTGG - Intronic
956039929 3:65135045-65135067 ATATAGTGGCTTAAATAAGATGG - Intergenic
957149911 3:76473310-76473332 TTCTATTGGCTCAAGGAAGAGGG - Intronic
960344343 3:116513965-116513987 ATCAAATGGCTAAAGGAAGAAGG + Intronic
961552730 3:127678355-127678377 ATCTGGTGGCTTAAAGAAGAGGG + Intronic
962036680 3:131659294-131659316 ATAAAGTTGCTTAATGATGAAGG - Intronic
963461636 3:145621644-145621666 ATCTAGTAGATTAATGTTGAGGG - Intergenic
963837950 3:150075859-150075881 ATCGAGTGACTCAATGAATAAGG + Intergenic
966148191 3:176835625-176835647 ATCTAGTTAGTTAATGAACAAGG - Intergenic
970646857 4:18132032-18132054 ACCAAGTGGCTCTATGAAGACGG - Intergenic
970970125 4:21973168-21973190 AACTAGTGGTTTAGTGAAAAGGG - Intergenic
974206536 4:58709728-58709750 ATCTTGTGGCTAAATGCAGAAGG + Intergenic
976323930 4:83749813-83749835 ACCTTGTGGCTTTATGAAGAAGG + Intergenic
978183442 4:105830469-105830491 ATCTAGTAGCTTGCTGAAAAGGG - Intronic
979447867 4:120835952-120835974 ATCAAGTGGCTTCATAATGAGGG + Intronic
980609570 4:135140446-135140468 ATCTTTTGGATTAAGGAAGAGGG - Intergenic
981272509 4:142861030-142861052 AAGTAGTGCCTCAATGAAGAAGG + Intergenic
983601058 4:169528405-169528427 TCCTCGTGGCTTAATGAACAAGG - Intronic
983789048 4:171772180-171772202 ATCAAGTAGGGTAATGAAGAGGG - Intergenic
987975549 5:25010801-25010823 ATCTGGTGGCTTTATAAAGGAGG - Intergenic
988228925 5:28449395-28449417 ATCTAGTGCCTTCAGGATGATGG - Intergenic
991153442 5:63399847-63399869 ACCTAGTTGATTAGTGAAGAAGG - Intergenic
991159614 5:63482571-63482593 AGCTGGTGGGATAATGAAGAAGG + Intergenic
992348572 5:75906259-75906281 ATCGAGTGGCTTAAAGGAGCAGG - Intergenic
993649633 5:90504033-90504055 AACTAGTAGCTTAATGCAAAAGG + Intronic
998758100 5:145403021-145403043 GTCTAGTGGCTCAAGGAAGTGGG - Intergenic
1002600305 5:180350601-180350623 CACTAGTGGCTGAATGAAAAAGG + Intronic
1003094304 6:3130511-3130533 AGCTAGTGGCCTGAGGAAGAGGG - Intronic
1003442170 6:6153203-6153225 ATATAGTGGCTAAAGGAACATGG - Intronic
1004340018 6:14799714-14799736 CTCTATTGGCTTTATGGAGAAGG + Intergenic
1004687959 6:17965682-17965704 ATCCAGTGGCTTTATTAACAGGG + Intronic
1006642127 6:35494942-35494964 ATCCAGTGGCCCAAAGAAGAAGG - Intronic
1007003822 6:38340717-38340739 TTCTAGGGACTAAATGAAGAAGG + Intronic
1010041242 6:71387344-71387366 ATCTAGTTGCTTAATCACCAGGG + Intergenic
1013028286 6:106302613-106302635 ATCTAGAGGCTAGATGATGAGGG + Intronic
1013577538 6:111499581-111499603 ATCTACCTGCTTAATTAAGAGGG + Intergenic
1014189892 6:118483155-118483177 ATCTAGTGGATTTATAAATAAGG + Intronic
1015238566 6:130998351-130998373 AGCTAGTTGCTTAATGAATTGGG + Intronic
1016941610 6:149486929-149486951 ATTAAGTGGCTGAGTGAAGATGG + Intergenic
1017046082 6:150348387-150348409 AGCCAGTGGCTTAAAGAACAGGG + Intergenic
1019229209 6:170544007-170544029 ATGAAGTGGCCTAAGGAAGATGG + Intronic
1020752583 7:12161324-12161346 ATCTGGAGGCTTAATGGGGAAGG - Intergenic
1021029600 7:15714891-15714913 ATCTAGGGGCTTACTTTAGAAGG + Intergenic
1021409423 7:20312930-20312952 ATCTGTTGGCTGCATGAAGAAGG + Intergenic
1022582463 7:31569541-31569563 ATGTACTGGCTCAATGGAGAGGG - Intronic
1023506957 7:40909779-40909801 ATCTCGTGGCTTTATCAGGAAGG + Intergenic
1027216194 7:76185516-76185538 ATCTGGTGGCTTAGGGAGGAGGG - Intergenic
1027480376 7:78688128-78688150 ATCAAGAGGCTAAATGAACATGG - Intronic
1030048381 7:105517573-105517595 ATCTAGTATTTTAATGAAAAGGG - Intronic
1030638243 7:111974469-111974491 ATCAGGTGGCATATTGAAGAGGG + Intronic
1032976031 7:137223732-137223754 ATTTTGTCTCTTAATGAAGATGG - Intergenic
1033101072 7:138472674-138472696 ATCTAGTGCCTTTTTGAAGCAGG + Intronic
1033148762 7:138894560-138894582 ATCTAGTGCATGAGTGAAGAAGG - Intronic
1034782297 7:153891705-153891727 ATTGAGTTGCTTAATGAAGTTGG + Intronic
1034782540 7:153894084-153894106 ATTGAGTTGCTTAATGAAAATGG + Intronic
1036936517 8:13007534-13007556 AACTTGTGGCTTGCTGAAGATGG + Intronic
1037152401 8:15653990-15654012 GGCTAGTGGGTTAATGAATATGG + Intronic
1042644656 8:70973173-70973195 ATCTTCTGGCTTAATCTAGAAGG + Intergenic
1045635029 8:104175140-104175162 ATCTTTTGGCTTAACGAAAATGG - Intronic
1046375847 8:113379098-113379120 AAATAGTGGGTTAATGAAAAGGG + Intronic
1048865291 8:138756318-138756340 ATAAAGTGACTTAATGAAAATGG - Intronic
1049123720 8:140766279-140766301 GTCTACTGCCTTAATGAAGAAGG + Intronic
1053949032 9:43348061-43348083 ATCTAATGGATTAATCAAAAGGG - Intergenic
1055437722 9:76309239-76309261 ATCTAAAGGCATGATGAAGAGGG + Intronic
1057901544 9:98952980-98953002 AATTCGTGGCTTAATGAAGGAGG - Intronic
1058669025 9:107345099-107345121 ATTTGTTGGCTTAATAAAGAAGG - Intergenic
1203592212 Un_KI270747v1:76262-76284 ATCTAATGGATTAATCAAAAGGG - Intergenic
1186941198 X:14509563-14509585 ATGTAGTGGCTTCATAAAGTGGG + Intergenic
1187301610 X:18056402-18056424 AACTTGTGGGTTAATGAAGTGGG - Intergenic
1191638345 X:63402417-63402439 ATGTAGTGGCTGAATGAATTTGG - Intergenic
1193308979 X:79982591-79982613 ATCCAGTGGCATAAGTAAGATGG - Intergenic
1200913184 Y:8548973-8548995 GTCTTGTGGCTTGATGGAGAAGG + Intergenic