ID: 1121597759

View in Genome Browser
Species Human (GRCh38)
Location 14:95178856-95178878
Sequence CCCAGGTCACATTCTCTTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121597745_1121597759 29 Left 1121597745 14:95178804-95178826 CCTGTGGGTCTCTCTGAGCCCTG No data
Right 1121597759 14:95178856-95178878 CCCAGGTCACATTCTCTTGGGGG No data
1121597749_1121597759 5 Left 1121597749 14:95178828-95178850 CCACCAGAAGCAGCTGCAGATCC No data
Right 1121597759 14:95178856-95178878 CCCAGGTCACATTCTCTTGGGGG No data
1121597746_1121597759 11 Left 1121597746 14:95178822-95178844 CCCTGCCCACCAGAAGCAGCTGC No data
Right 1121597759 14:95178856-95178878 CCCAGGTCACATTCTCTTGGGGG No data
1121597744_1121597759 30 Left 1121597744 14:95178803-95178825 CCCTGTGGGTCTCTCTGAGCCCT No data
Right 1121597759 14:95178856-95178878 CCCAGGTCACATTCTCTTGGGGG No data
1121597748_1121597759 6 Left 1121597748 14:95178827-95178849 CCCACCAGAAGCAGCTGCAGATC No data
Right 1121597759 14:95178856-95178878 CCCAGGTCACATTCTCTTGGGGG No data
1121597750_1121597759 2 Left 1121597750 14:95178831-95178853 CCAGAAGCAGCTGCAGATCCCAT No data
Right 1121597759 14:95178856-95178878 CCCAGGTCACATTCTCTTGGGGG No data
1121597747_1121597759 10 Left 1121597747 14:95178823-95178845 CCTGCCCACCAGAAGCAGCTGCA No data
Right 1121597759 14:95178856-95178878 CCCAGGTCACATTCTCTTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121597759 Original CRISPR CCCAGGTCACATTCTCTTGG GGG Intergenic
No off target data available for this crispr