ID: 1121599346

View in Genome Browser
Species Human (GRCh38)
Location 14:95191551-95191573
Sequence CAGGCTCTGATACGTGTGTC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 84
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 76}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121599346_1121599348 -5 Left 1121599346 14:95191551-95191573 CCAGACACACGTATCAGAGCCTG 0: 1
1: 0
2: 0
3: 7
4: 76
Right 1121599348 14:95191569-95191591 GCCTGCTAACATCCAGTTGTGGG 0: 1
1: 0
2: 0
3: 4
4: 98
1121599346_1121599351 19 Left 1121599346 14:95191551-95191573 CCAGACACACGTATCAGAGCCTG 0: 1
1: 0
2: 0
3: 7
4: 76
Right 1121599351 14:95191593-95191615 AGAGCAGCAAGCAGTACACCAGG 0: 1
1: 0
2: 1
3: 18
4: 245
1121599346_1121599352 28 Left 1121599346 14:95191551-95191573 CCAGACACACGTATCAGAGCCTG 0: 1
1: 0
2: 0
3: 7
4: 76
Right 1121599352 14:95191602-95191624 AGCAGTACACCAGGAGCCACAGG 0: 1
1: 0
2: 0
3: 12
4: 172
1121599346_1121599347 -6 Left 1121599346 14:95191551-95191573 CCAGACACACGTATCAGAGCCTG 0: 1
1: 0
2: 0
3: 7
4: 76
Right 1121599347 14:95191568-95191590 AGCCTGCTAACATCCAGTTGTGG 0: 1
1: 0
2: 0
3: 6
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121599346 Original CRISPR CAGGCTCTGATACGTGTGTC TGG (reversed) Exonic
900572927 1:3368285-3368307 CAGGCTCCGACACCTCTGTCTGG + Intronic
902657888 1:17882033-17882055 CAGCCTCTGATTGGTGAGTCTGG - Intergenic
907480637 1:54743501-54743523 CAGGCTCTGTTTCCCGTGTCAGG - Intergenic
909060012 1:70869058-70869080 CAGGCTGTAATACGTGAGACTGG - Intronic
913225440 1:116694569-116694591 CAGGCTGTGATGGGTGTGGCAGG - Intronic
916787593 1:168097749-168097771 CAGGCCCTGATACTTGGCTCAGG - Intronic
922807365 1:228397349-228397371 GAGGCTCTGACATGTGTGCCAGG + Intronic
923419135 1:233795502-233795524 CAAGCTCTGAGACCAGTGTCTGG - Intergenic
1062932657 10:1363219-1363241 CGGGCTGCGCTACGTGTGTCTGG - Exonic
1067282124 10:44880689-44880711 CAGGCTCTGATCAGGGTGTTGGG + Intergenic
1068695746 10:59966478-59966500 GAGGATCTGATGCTTGTGTCTGG - Intergenic
1073286158 10:102390002-102390024 CAAGCTCTGATACAAGTGTTTGG - Intergenic
1074828208 10:117229690-117229712 AAGGCTGTAATACATGTGTCTGG - Intergenic
1076818368 10:132925742-132925764 CGGGCTGTGACACGTGTGCCAGG + Intronic
1077722575 11:4643341-4643363 CAGGCTCTGGTCCCTGTGTCTGG - Intergenic
1079485697 11:20934053-20934075 CAGGCTCTGGTGCGTTTGGCTGG - Intronic
1081665963 11:44917289-44917311 CAGGCTCTGTTACCTCTGCCAGG - Intronic
1084266747 11:68008919-68008941 CTGGCTCTGACAGGTGTATCCGG + Intronic
1089331082 11:117689500-117689522 CAGGGTATGAAACGTGTTTCTGG + Intronic
1090993069 11:131838247-131838269 CGGGCTCTGTCATGTGTGTCAGG + Intronic
1098455771 12:70671909-70671931 CAGGCTCTGATGCTGGTCTCTGG + Intronic
1103051440 12:117783393-117783415 GAGGCTCTGATAAGTGAATCAGG - Intronic
1110030656 13:70608400-70608422 CAGGCTTTGAGACAGGTGTCTGG - Intergenic
1119640085 14:76308379-76308401 CAGGCTCAGAGGTGTGTGTCCGG + Intergenic
1120094822 14:80376503-80376525 CAGGCTCTGAAGCATGTGTGAGG - Intronic
1121599346 14:95191551-95191573 CAGGCTCTGATACGTGTGTCTGG - Exonic
1124264224 15:28219335-28219357 CAGGCTCTGATGCCTCTGTGGGG + Intronic
1125077582 15:35637448-35637470 CAGGCTCTGTGACATGTTTCAGG - Intergenic
1133394376 16:5434277-5434299 CTCCCTCTGATGCGTGTGTCTGG - Intergenic
1141570770 16:84932402-84932424 CAGGCCCTGATCTCTGTGTCGGG + Intergenic
1147035444 17:37676454-37676476 CAGGCTCTGATTGGTTTGTGGGG - Intergenic
1147662834 17:42126192-42126214 CAGGCTCTGAAATGGGTGGCAGG + Intronic
1150617428 17:66783152-66783174 CAGGCTCTGTCACGGGTGTTTGG + Intronic
1151378528 17:73708560-73708582 CAGGCTCAGATAGGTGGGTGGGG - Intergenic
1157602485 18:48902473-48902495 CTGGCTCTGTTAGGTGTGTGGGG - Intergenic
1162207399 19:9065926-9065948 CAGGCTCAGCTGCGGGTGTCAGG + Intergenic
1163199031 19:15749292-15749314 AAGGCTCAGCTACATGTGTCAGG - Intergenic
924987028 2:281415-281437 CAGGCTCTGATGTGGTTGTCTGG + Intronic
927222475 2:20726168-20726190 CAGGCTCTGGTACTTGAGTGGGG + Intronic
928888207 2:36174310-36174332 GAGGCTCTGAGATGTGTGTATGG + Intergenic
930362375 2:50398070-50398092 CAGCCTCTGAAACGTGTGTGTGG - Intronic
931057923 2:58493612-58493634 CAGTATCTGATATGAGTGTCTGG - Intergenic
931748736 2:65312978-65313000 CAGGCTGAGATACTTCTGTCGGG + Exonic
932267673 2:70382246-70382268 AAGGCTATTATAAGTGTGTCAGG + Intergenic
934576574 2:95405550-95405572 CAGGCTCTGATGCTGGTGTCTGG + Exonic
934638799 2:96013721-96013743 CAGGCTCTGATGGTGGTGTCTGG + Intergenic
934794854 2:97091693-97091715 CAGGCTCTGATGCTGGTGTCTGG - Exonic
946425434 2:219592927-219592949 CAGGCTCTGATGAGCGTGCCTGG + Intergenic
1172240719 20:33410976-33410998 CTGGCTCTGGCCCGTGTGTCAGG - Intronic
1181337798 22:22153961-22153983 CAGGCCCAGATACATGTGTAAGG + Intergenic
1182764795 22:32750969-32750991 CAGTCTCTGATATGTGAATCTGG + Intronic
1185279454 22:49963736-49963758 CAGGCCCTGATTCCTGTGCCTGG + Exonic
953129058 3:40120454-40120476 CAGGCTCACATCAGTGTGTCAGG + Intronic
963009079 3:140752573-140752595 CATGGTCTGATACCTGAGTCAGG - Intergenic
965884926 3:173433389-173433411 CAGGCTCTGATCCCTTTCTCTGG + Intronic
979550848 4:121989159-121989181 CAAGGTCTGATAGGTGAGTCTGG + Intergenic
985869324 5:2541395-2541417 CAGGCTCTGCTGTGTGTGTGTGG + Intergenic
986101172 5:4613042-4613064 CAGGCTCTGTCACCTCTGTCTGG - Intergenic
992627860 5:78650150-78650172 CAGGCTCTGAGAAGTGCGTATGG - Intronic
993706460 5:91177307-91177329 CAGGCTAGGACATGTGTGTCAGG + Intergenic
996624479 5:125553309-125553331 CAGGCTCTCATCAGTGTGTTCGG - Intergenic
997531452 5:134583976-134583998 CAGGCTCTGAAAAGAGTGTGGGG + Intergenic
1001673577 5:173494018-173494040 AAGGCACTGGTACGGGTGTCTGG + Intergenic
1004351977 6:14898105-14898127 AAGGCTCTGATATGTCTGTTGGG - Intergenic
1006943707 6:37770063-37770085 CAGCTTATGATACGTTTGTCTGG - Intergenic
1010398730 6:75424023-75424045 CAGGCTGTTATCAGTGTGTCAGG - Intronic
1010727898 6:79356019-79356041 CAGGCTCTGGTATGAGTGCCAGG - Intergenic
1010780631 6:79942704-79942726 CAGGTTCTAAAACGGGTGTCAGG - Intronic
1013650240 6:112187582-112187604 CAGGCTGTGATAAGTGCGTCTGG - Exonic
1018788543 6:167128235-167128257 CAGGTTCTGGTGCCTGTGTCAGG + Intronic
1019005366 6:168792316-168792338 AAGGCTCTGAAAGGTGTTTCTGG + Intergenic
1022491652 7:30825076-30825098 CATGCTTTGATACATGTCTCCGG + Intronic
1025071563 7:55904139-55904161 CAGTATCTGATACGGGTGACTGG - Intronic
1035842932 8:2832081-2832103 CAGGTTCTGAGACGTGCATCAGG + Intergenic
1036618427 8:10406143-10406165 CAGGCTCACACACTTGTGTCGGG + Intronic
1040727671 8:50402303-50402325 CAGGATGTGATATGTGTGTCTGG + Exonic
1044150206 8:88767231-88767253 TAGGTTCAGATATGTGTGTCAGG + Intergenic
1048274618 8:133056932-133056954 CAGGTTCTGATTCGTGGGCCTGG + Intronic
1050309324 9:4336478-4336500 AGGGCACTGATACATGTGTCGGG + Intronic
1050584075 9:7091891-7091913 CAGGGTCTGAGACCTGTGTCAGG - Intergenic
1057140758 9:92725578-92725600 CAAGCTCTGCTGCGTGTGACTGG + Intronic
1195111882 X:101657826-101657848 CAGGCCTTGACACCTGTGTCTGG - Intronic
1196292090 X:113954450-113954472 CATGCTCTGAAATGTGTGTGTGG - Intergenic
1198764861 X:140070171-140070193 AAGGCACTGATACATGTGTGAGG + Intergenic