ID: 1121599698

View in Genome Browser
Species Human (GRCh38)
Location 14:95194148-95194170
Sequence GGATTGGGGTGTGCTGCTCC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 287
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 267}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121599682_1121599698 14 Left 1121599682 14:95194111-95194133 CCCTTGTGAGTGCGAGAGACCCC 0: 1
1: 0
2: 0
3: 3
4: 70
Right 1121599698 14:95194148-95194170 GGATTGGGGTGTGCTGCTCCGGG 0: 1
1: 0
2: 0
3: 19
4: 267
1121599678_1121599698 25 Left 1121599678 14:95194100-95194122 CCTAAGCCCCTCCCTTGTGAGTG 0: 1
1: 0
2: 0
3: 9
4: 214
Right 1121599698 14:95194148-95194170 GGATTGGGGTGTGCTGCTCCGGG 0: 1
1: 0
2: 0
3: 19
4: 267
1121599676_1121599698 27 Left 1121599676 14:95194098-95194120 CCCCTAAGCCCCTCCCTTGTGAG 0: 1
1: 0
2: 3
3: 26
4: 181
Right 1121599698 14:95194148-95194170 GGATTGGGGTGTGCTGCTCCGGG 0: 1
1: 0
2: 0
3: 19
4: 267
1121599688_1121599698 -7 Left 1121599688 14:95194132-95194154 CCACCACCCGGAACCCGGATTGG 0: 1
1: 0
2: 0
3: 3
4: 57
Right 1121599698 14:95194148-95194170 GGATTGGGGTGTGCTGCTCCGGG 0: 1
1: 0
2: 0
3: 19
4: 267
1121599680_1121599698 18 Left 1121599680 14:95194107-95194129 CCCTCCCTTGTGAGTGCGAGAGA 0: 1
1: 0
2: 0
3: 16
4: 130
Right 1121599698 14:95194148-95194170 GGATTGGGGTGTGCTGCTCCGGG 0: 1
1: 0
2: 0
3: 19
4: 267
1121599679_1121599698 19 Left 1121599679 14:95194106-95194128 CCCCTCCCTTGTGAGTGCGAGAG 0: 1
1: 0
2: 0
3: 8
4: 161
Right 1121599698 14:95194148-95194170 GGATTGGGGTGTGCTGCTCCGGG 0: 1
1: 0
2: 0
3: 19
4: 267
1121599686_1121599698 -5 Left 1121599686 14:95194130-95194152 CCCCACCACCCGGAACCCGGATT 0: 1
1: 0
2: 0
3: 3
4: 64
Right 1121599698 14:95194148-95194170 GGATTGGGGTGTGCTGCTCCGGG 0: 1
1: 0
2: 0
3: 19
4: 267
1121599692_1121599698 -10 Left 1121599692 14:95194135-95194157 CCACCCGGAACCCGGATTGGGGT 0: 1
1: 0
2: 1
3: 2
4: 48
Right 1121599698 14:95194148-95194170 GGATTGGGGTGTGCTGCTCCGGG 0: 1
1: 0
2: 0
3: 19
4: 267
1121599681_1121599698 17 Left 1121599681 14:95194108-95194130 CCTCCCTTGTGAGTGCGAGAGAC 0: 1
1: 0
2: 0
3: 4
4: 78
Right 1121599698 14:95194148-95194170 GGATTGGGGTGTGCTGCTCCGGG 0: 1
1: 0
2: 0
3: 19
4: 267
1121599687_1121599698 -6 Left 1121599687 14:95194131-95194153 CCCACCACCCGGAACCCGGATTG 0: 1
1: 0
2: 0
3: 1
4: 36
Right 1121599698 14:95194148-95194170 GGATTGGGGTGTGCTGCTCCGGG 0: 1
1: 0
2: 0
3: 19
4: 267
1121599677_1121599698 26 Left 1121599677 14:95194099-95194121 CCCTAAGCCCCTCCCTTGTGAGT 0: 1
1: 0
2: 0
3: 12
4: 143
Right 1121599698 14:95194148-95194170 GGATTGGGGTGTGCTGCTCCGGG 0: 1
1: 0
2: 0
3: 19
4: 267
1121599675_1121599698 30 Left 1121599675 14:95194095-95194117 CCTCCCCTAAGCCCCTCCCTTGT 0: 1
1: 0
2: 0
3: 26
4: 351
Right 1121599698 14:95194148-95194170 GGATTGGGGTGTGCTGCTCCGGG 0: 1
1: 0
2: 0
3: 19
4: 267
1121599683_1121599698 13 Left 1121599683 14:95194112-95194134 CCTTGTGAGTGCGAGAGACCCCA 0: 1
1: 0
2: 2
3: 3
4: 86
Right 1121599698 14:95194148-95194170 GGATTGGGGTGTGCTGCTCCGGG 0: 1
1: 0
2: 0
3: 19
4: 267

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121599698 Original CRISPR GGATTGGGGTGTGCTGCTCC GGG Intronic
900441523 1:2657924-2657946 GGAGTGGTGGGTGCTGCTCCAGG - Intronic
900443149 1:2666352-2666374 GGGGTGTGGGGTGCTGCTCCAGG - Intronic
900444043 1:2670968-2670990 GGGGTGTGGGGTGCTGCTCCAGG - Intronic
900444311 1:2672334-2672356 GGAGTGGTGGGTGCTGCTCCAGG - Intronic
900444946 1:2675624-2675646 GGGGTGTGGGGTGCTGCTCCAGG - Intronic
900445213 1:2676990-2677012 GGAGTGGTGGGTGCTGCTCCAGG - Intronic
900445655 1:2679358-2679380 GGGGTGTGGGGTGCTGCTCCAGG - Intronic
900445925 1:2680724-2680746 GGAGTGGTGGGTGCTGCTCCAGG - Intronic
900446199 1:2682169-2682191 GGAGTGGTGGGTGCTGCTCCAGG - Intronic
900447110 1:2686824-2686846 GGGGTGTGGGGTGCTGCTCCAGG - Intronic
900447390 1:2688189-2688211 GGGGTGTGGGGTGCTGCTCCAGG - Intronic
900448607 1:2694250-2694272 GGGGTGTGGGGTGCTGCTCCAGG - Intronic
900449060 1:2696500-2696522 GGGGTGTGGGGTGCTGCTCCAGG - Intronic
900449441 1:2698387-2698409 GGTGTGTGGGGTGCTGCTCCAGG - Intronic
900452527 1:2757451-2757473 GGGGTGTGGGGTGCTGCTCCAGG - Intronic
900452909 1:2759338-2759360 GGTGTGTGGGGTGCTGCTCCAGG - Intronic
900452936 1:2759459-2759481 GGGGTGTGGGGTGCTGCTCCAGG - Intronic
900453434 1:2762072-2762094 GGGGTTGTGTGTGCTGCTCCAGG - Intronic
900453440 1:2762112-2762134 GGGGTTGTGTGTGCTGCTCCAGG - Intronic
900453870 1:2764283-2764305 GGGGTTGTGTGTGCTGCTCCAGG - Intronic
900454096 1:2765452-2765474 GGGGTGTGGGGTGCTGCTCCAGG - Intronic
900455316 1:2771545-2771567 GGGGTTGTGTGTGCTGCTCCAGG - Intronic
900455543 1:2772714-2772736 GGGGTGTGGGGTGCTGCTCCAGG - Intronic
900455632 1:2773119-2773141 GGGGTTGTGTGTGCTGCTCCAGG - Intronic
900671699 1:3858369-3858391 GGATGGTGGTGTTCAGCTCCTGG + Intronic
900915775 1:5637410-5637432 AGATTGAGGACTGCTGCTCCAGG - Intergenic
902250681 1:15152976-15152998 GGATGGGGGCGCGCTGCACCGGG - Intronic
902580186 1:17403098-17403120 GGCTGGGGGGGTGCTTCTCCAGG - Intergenic
904443897 1:30551881-30551903 GCAGTGGGGTGGGCAGCTCCAGG - Intergenic
905546219 1:38802307-38802329 GCAGTGGGGTGGGCAGCTCCAGG - Intergenic
906132334 1:43468147-43468169 GCAGTGGGGTGGGCAGCTCCAGG + Intergenic
907915219 1:58862024-58862046 GGATTGGAGTGAGCTGCTGCTGG - Intergenic
911138544 1:94470401-94470423 GGATTCTGTTGTGCAGCTCCAGG + Intronic
911150698 1:94594766-94594788 GGCTTGGGGTGTGGTCCTTCAGG + Intergenic
918107839 1:181428600-181428622 TGGTTGGTGTGTGCTGCTCTTGG + Intronic
920756900 1:208741102-208741124 GGATGGGGGTGTGGTGGGCCAGG + Intergenic
921212994 1:212915899-212915921 CCCTTGGGCTGTGCTGCTCCAGG + Intergenic
921982133 1:221270594-221270616 GGATGAGGGTGTTCTGTTCCAGG - Intergenic
922571906 1:226639439-226639461 GGGCTGGGGTGTGCTGTCCCTGG + Intronic
923292048 1:232555357-232555379 GGGTGGGGTTATGCTGCTCCAGG - Intronic
923786076 1:237070734-237070756 GGGGTGGGGTGGGCTGCTCCAGG + Intronic
1062897429 10:1114971-1114993 GGATTGGGGTGTGCTGAGGGAGG - Intronic
1062938818 10:1406924-1406946 GGATGGGGATGGGCTGCTTCTGG - Intronic
1063357796 10:5417292-5417314 GGATGGGGGTGTGGTGAGCCAGG + Intronic
1069634353 10:69916430-69916452 GGAGTGGGGAGGGCAGCTCCTGG - Intronic
1070170871 10:73931965-73931987 GGGTTGGGCTGTTCAGCTCCAGG + Intergenic
1070284240 10:75071801-75071823 GGATTGGGGTGTGGCGGGCCAGG - Intergenic
1070756837 10:78998567-78998589 GGATTGGGCAGTGATGCTTCAGG - Intergenic
1070772935 10:79092932-79092954 GGCTTTGGGGGTGCTGCTTCCGG - Intronic
1072211700 10:93252372-93252394 GGTTTGGGGTGATCTGTTCCTGG + Intergenic
1072520215 10:96224309-96224331 GGGTGGGGGTGAGGTGCTCCTGG + Intronic
1073131921 10:101195209-101195231 AGCCTGGGGTGTACTGCTCCCGG - Intergenic
1073300436 10:102467982-102468004 GGATGGGGGTGTGGTGGGCCGGG + Intronic
1074384580 10:113006805-113006827 GGACAGGGCTGTGCTGCTGCTGG + Intronic
1074414245 10:113253231-113253253 GGATCGGGCAGTGCAGCTCCTGG - Intergenic
1075542279 10:123324984-123325006 GGAGTGAGGTGGGCTGCTCAGGG - Intergenic
1075705982 10:124501254-124501276 GGAATGGGGAGTGCAGCTTCAGG + Intronic
1077184405 11:1229836-1229858 GGGGTGGGGTGTGGAGCTCCTGG + Intronic
1077184420 11:1229887-1229909 GGGTGGGGGTGTGGAGCTCCTGG + Intronic
1082842537 11:57700842-57700864 GGATTAGAGTGTGCTCCTACTGG + Exonic
1083205519 11:61146527-61146549 CGCCTGGGCTGTGCTGCTCCTGG - Intronic
1083302568 11:61746574-61746596 GGTTAGGGGTGGGCTGCCCCTGG - Exonic
1083350146 11:62022261-62022283 GGTTTGGGATGTTCTGTTCCAGG - Intergenic
1084493155 11:69489128-69489150 GGATTGGGGGGAGCTGGACCAGG + Intergenic
1084548169 11:69824890-69824912 GGACTGGGGTGCGCTACTCTGGG - Intergenic
1084720713 11:70903960-70903982 GGAATTTGGGGTGCTGCTCCTGG - Intronic
1085169994 11:74441778-74441800 GGTTTGGGCTGTGCTCCTCTAGG - Intergenic
1089592008 11:119547639-119547661 GCAGTGGGGTGAGCAGCTCCAGG - Intergenic
1089640394 11:119843990-119844012 TGCTTGGTGTGTGCTGCTTCCGG - Intergenic
1091299886 11:134500933-134500955 GGAATGGGGAGTGCAGCTCAAGG + Intergenic
1091785688 12:3242236-3242258 GGATGGGGTTGAGCTGCTTCAGG + Intronic
1094720030 12:33053202-33053224 GGAGTGGGGGGTGTTTCTCCAGG - Intergenic
1096654207 12:53078655-53078677 GGATGGGGGTGGGATGATCCAGG + Intronic
1096874101 12:54613982-54614004 GGGTTGGGGGGTGCAGCTGCTGG - Intergenic
1097084252 12:56455540-56455562 GGCTTAGGGTGTGCTGATCATGG - Intronic
1097298858 12:57997308-57997330 GCAATGGGGTGGGCAGCTCCAGG + Intergenic
1098268586 12:68747990-68748012 GGAATGGTGTTTGCTGCTCTTGG + Exonic
1098826784 12:75306689-75306711 GTATTGGGGTAGGCTGCTCCTGG + Intronic
1102964179 12:117113429-117113451 GGCTCGGGGCCTGCTGCTCCAGG + Intergenic
1103465595 12:121139678-121139700 GGATTTGGATTTGCTCCTCCTGG - Intronic
1103539938 12:121659046-121659068 GGACAGGGTTGTGCTGCTCGTGG - Intronic
1105041988 12:132967858-132967880 GCAGTGGGGTGGGCAGCTCCAGG - Intergenic
1109512453 13:63396927-63396949 GCAGTGGGGTGGGCAGCTCCAGG - Intergenic
1111343979 13:86924779-86924801 GGATGGGGGTGTGATGGGCCAGG + Intergenic
1112086227 13:96034770-96034792 GCAGTGGGGTGGGCAGCTCCAGG - Intronic
1112814172 13:103252398-103252420 GGATTGGGGAGTGGTGGGCCAGG + Intergenic
1113327115 13:109293106-109293128 GGAATGGGGTGAGATACTCCAGG + Intergenic
1121269942 14:92631314-92631336 GGATGGGGGCGTCCTGCTCTGGG - Intronic
1121599698 14:95194148-95194170 GGATTGGGGTGTGCTGCTCCGGG + Intronic
1122466156 14:101934965-101934987 GTATTGGGGTTCGGTGCTCCTGG - Intergenic
1123063208 14:105603716-105603738 GGGTTGGGCTGGGCTGCTCTAGG - Intergenic
1202840299 14_GL000009v2_random:115006-115028 GCAGTGGGGTGGGCAGCTCCAGG - Intergenic
1202909682 14_GL000194v1_random:105203-105225 GCAGTGGGGTGGGCAGCTCCAGG - Intergenic
1123690599 15:22835698-22835720 GGGTTGGGGACTGCTGCTCTAGG - Intergenic
1127261712 15:57331449-57331471 GGGTTGGGGTGTCCAGATCCTGG + Intergenic
1129394061 15:75234764-75234786 GGATTAGGGTGGGCTGGGCCTGG - Intergenic
1129753129 15:78079929-78079951 GGAGTGGAGTGGGCTGCTCTCGG + Intronic
1130585105 15:85174452-85174474 GGATGGGAATGTGCTGTTCCGGG + Intergenic
1130704003 15:86214802-86214824 CGATTGTGGTGCTCTGCTCCTGG + Intronic
1131520330 15:93109655-93109677 GGATGCGGGTGTTGTGCTCCTGG + Intergenic
1132011061 15:98277092-98277114 GCAGTGTGCTGTGCTGCTCCTGG - Intergenic
1132018246 15:98338049-98338071 AGATTTGGGTTTGCTGCTCTTGG - Intergenic
1132572914 16:651776-651798 GGGTTGGGGTGTGATGGCCCAGG + Intronic
1132891426 16:2206688-2206710 GGGCTGGGGTGGGCTGCTCTGGG + Intronic
1134086905 16:11363489-11363511 GGATTGGAGTAGGGTGCTCCAGG + Intronic
1136070679 16:27785158-27785180 GGCTTGGGGTGCGCTGGCCCCGG - Intergenic
1137786209 16:51139860-51139882 GCATTCGGATGTGCTGCTGCAGG + Exonic
1138113428 16:54342146-54342168 GAGATGGGGTGTGGTGCTCCGGG + Intergenic
1139540398 16:67610967-67610989 GGATGGGGGTGAGGTGGTCCAGG + Exonic
1140199327 16:72881792-72881814 GGATTTGGGGGTGCTGTCCCTGG - Intronic
1140473176 16:75226144-75226166 GGATTGGGGTGTGGGGCCCGGGG - Intergenic
1141889434 16:86916765-86916787 GCACTGGGGTGTGTGGCTCCAGG + Intergenic
1141957285 16:87381431-87381453 TGAGTGGGAAGTGCTGCTCCCGG - Intronic
1142288226 16:89180160-89180182 GGTTTGGGGAGAGCTGCTCCGGG - Intronic
1142317951 16:89361046-89361068 GGGCTGGGGTGGGCTGATCCTGG - Intronic
1142854523 17:2722439-2722461 GGTCTGGGGTGTCCAGCTCCTGG - Intergenic
1143096834 17:4482813-4482835 GGATTGGGGTGAGCTGGCTCTGG - Intronic
1143746025 17:8994730-8994752 GGTCTGGGGTTTGCTGATCCTGG - Intergenic
1146788721 17:35739509-35739531 GGATTGGGGGGTACAGCTCAAGG - Intronic
1147769778 17:42859550-42859572 GGATTGGGGTGTGGGGCTGGAGG - Intergenic
1147917212 17:43896024-43896046 GGAGTGGGGATTGCTGCTGCAGG - Intronic
1150952923 17:69822573-69822595 GCAGTGGGGTGGGCAGCTCCAGG - Intergenic
1151236072 17:72720523-72720545 GGAGTGGGGAGTGCTTGTCCTGG + Intronic
1151362803 17:73598697-73598719 GGAGGGGGATGGGCTGCTCCCGG - Intronic
1152008582 17:77697136-77697158 GGGTGGGTGTGTGCTGCCCCGGG + Intergenic
1152353929 17:79797752-79797774 GGGGTCGGGTGTGCGGCTCCGGG - Intronic
1152517901 17:80836898-80836920 GAATTGGGGTGTGGAGCTCTGGG + Intronic
1152618081 17:81346841-81346863 GGATTGGCGTCCGCTGCCCCAGG + Intergenic
1153139249 18:1953808-1953830 GCAGTGGGGTGGGCAGCTCCAGG + Intergenic
1153561544 18:6376213-6376235 GGATTTGGGTGCCGTGCTCCAGG - Intronic
1154024073 18:10690336-10690358 GGATTGGCCTGGGCTCCTCCAGG + Intronic
1155651974 18:28153531-28153553 GGGTTGGGGGGTGTTGCCCCTGG - Intronic
1157594923 18:48858656-48858678 GGCCAGGGGTGTGCTGGTCCAGG + Intronic
1159416202 18:68152481-68152503 GGATAGGGGTGTGGTGGGCCAGG - Intergenic
1160715358 19:573861-573883 GGATTGAGGTGTGTTTTTCCGGG + Intronic
1161260841 19:3337019-3337041 GGCTGGGGGTGGGGTGCTCCGGG + Intergenic
1161421246 19:4176967-4176989 GGACTGGGGTGTGGCCCTCCTGG - Intronic
1161611918 19:5247939-5247961 GGAGTGGAGGGTACTGCTCCAGG + Intronic
1161735523 19:5990130-5990152 GGATTGGGCTGTAGTGCTCCTGG + Intergenic
1162110802 19:8398626-8398648 GGATGTGGGTTTGCTGCACCAGG + Intronic
1164835174 19:31351080-31351102 AGTCTGGGGTTTGCTGCTCCAGG - Intergenic
1202632755 1_KI270706v1_random:15545-15567 GCAGTGGGGTGGGCAGCTCCAGG + Intergenic
925801306 2:7604700-7604722 AGGTTGGGGACTGCTGCTCCAGG - Intergenic
925929736 2:8697394-8697416 GGGTAGGGCTGTGCTCCTCCTGG - Intergenic
926328011 2:11802039-11802061 GGCTTGGGATGTGCTGCTTTGGG + Intronic
926889429 2:17626535-17626557 GGGTTGGGGAGTGCTTCCCCTGG - Intronic
927707650 2:25306682-25306704 GGGCTGAGGTGTGCTGCTCGTGG - Intronic
929492575 2:42409026-42409048 GCAGTGGGGTGGGCAGCTCCAGG - Intronic
930165447 2:48199375-48199397 GGAATGGGCTGCGGTGCTCCAGG - Intergenic
930769492 2:55117426-55117448 GGATTGGGACTTGCTGCTCCAGG - Intergenic
931005712 2:57848960-57848982 GCAGTGGGGTGGGCAGCTCCAGG + Intergenic
931096462 2:58946135-58946157 TGATTGGGCTGTGCTCCGCCTGG + Intergenic
931827698 2:66018556-66018578 GGATTGGGGGGTGGGGCTCAGGG + Intergenic
933093409 2:78147541-78147563 GCCTTGGGGTGGGCAGCTCCAGG - Intergenic
934524076 2:95040638-95040660 TGAGTGGGGGGTGCTCCTCCTGG + Intronic
935588458 2:104823371-104823393 TGATTTGGGTCTGATGCTCCAGG - Intergenic
935667723 2:105526562-105526584 GCAGTGGGGTGGGCAGCTCCAGG - Intergenic
936052285 2:109233499-109233521 GGATGGGGGTGTGGTGGGCCAGG + Intronic
937219866 2:120336602-120336624 GGTATGGGGTGTGCTGCTTTGGG - Intergenic
939745076 2:145958034-145958056 GGATAGGGGTGTGGTTCTCAGGG + Intergenic
942384123 2:175423413-175423435 GGAAAGGTGTGTACTGCTCCAGG - Intergenic
943404366 2:187461600-187461622 GGATGGGGGTGTGGTGGGCCAGG - Intergenic
945923492 2:215779948-215779970 GGATTGGCCTGTGCTGCTCTTGG - Intergenic
946408700 2:219506018-219506040 GGGTGAGGGTGTGCGGCTCCGGG + Exonic
946418053 2:219550418-219550440 GGGTGGGGGGGTGCTGCTCTGGG + Exonic
947287567 2:228533393-228533415 GGATTGATGTGTGCTGCTTGTGG - Intergenic
947298159 2:228656238-228656260 GGATGGATGTGTGCTGCTTCCGG - Intergenic
947565543 2:231190762-231190784 GGATTGGGGTTGGCTGCGGCGGG - Intergenic
947794368 2:232884940-232884962 GATGTGGGGGGTGCTGCTCCAGG - Intronic
948615277 2:239194582-239194604 GGAGTGGGGAGTGCTGGGCCAGG - Intronic
948661261 2:239507990-239508012 GGCTTGGGTTGTGCAGCTCCAGG + Intergenic
949027233 2:241771976-241771998 GGTTTGGGGTTTGGGGCTCCTGG + Intergenic
949029881 2:241788866-241788888 GGATTGATGTGTGCTGCTTGTGG - Intronic
1170426201 20:16237601-16237623 GTTTTGGGGTGGGGTGCTCCTGG + Intergenic
1172576120 20:36010169-36010191 GGAGGGGGCTGTGCTGCTCTGGG - Intronic
1172768515 20:37363665-37363687 GGAATGGGGTGTGCTGATGGGGG - Intronic
1173421428 20:42904701-42904723 GGATGGGGGTGTGGTGGGCCAGG - Intronic
1173884438 20:46445228-46445250 GCAGTGGGGTGGGCAGCTCCAGG + Intergenic
1174395980 20:50247170-50247192 GGAGTTGGGGGTGCTGATCCTGG + Intergenic
1174633003 20:51974649-51974671 GGATTGAGGTGTGCTGAGGCTGG + Intergenic
1175304345 20:57965625-57965647 GGCTTGGGTTGGGCTGCCCCCGG - Intergenic
1176060570 20:63170772-63170794 AGATTGGGGTGGGCTGACCCTGG - Intergenic
1176599030 21:8775147-8775169 GCAGTGGGGTGGGCAGCTCCAGG + Intergenic
1176629030 21:9119911-9119933 GCAGTGGGGTGGGCAGCTCCAGG - Intergenic
1176644968 21:9341425-9341447 GCAGTGGGGTGGGCAGCTCCAGG + Intergenic
1177339483 21:19781875-19781897 GGATAGGGGTGTGGTGGACCAGG - Intergenic
1178678620 21:34652877-34652899 GCAATGGGGTGTGTTGCTGCTGG + Intergenic
1180367984 22:11957809-11957831 GCAGTGGGGTGGGCAGCTCCAGG - Intergenic
1181026103 22:20128620-20128642 GGGTTGGGGACTGCTGCTCTGGG + Intergenic
1181060482 22:20279948-20279970 GATTTGGGGTGAGCTGCACCGGG - Intronic
1181483238 22:23214456-23214478 GGCTTGGGAGGTGCTGCTCTTGG + Intronic
1182994653 22:34801210-34801232 GGATGGGGGTGTGGTGGGCCAGG - Intergenic
1184540811 22:45123025-45123047 GGAAGCGGGTGTCCTGCTCCAGG + Intergenic
1184934226 22:47707208-47707230 GGATGGGGGTGTGGTGGGCCAGG + Intergenic
1184988544 22:48152716-48152738 GGCTTGGGGTGGGGGGCTCCAGG - Intergenic
951107322 3:18760129-18760151 GGAGTGGGATGAGCTGCTGCTGG + Intergenic
952336824 3:32410670-32410692 GGGTGGGAGTGGGCTGCTCCAGG - Intronic
952564258 3:34635647-34635669 GGATGGGGGTGTGGTGGGCCAGG + Intergenic
953147321 3:40290758-40290780 GCAGTGGGGTGGGCAGCTCCAGG + Intergenic
953741361 3:45541872-45541894 GGATGCCAGTGTGCTGCTCCAGG + Exonic
954274739 3:49534928-49534950 GGATTTGTGTGTGCTGCCTCAGG + Exonic
954376113 3:50195030-50195052 GGATTTGGGGGTGAGGCTCCAGG - Intronic
954726958 3:52620455-52620477 GGAATGGGGTGAGCACCTCCTGG - Intronic
954796814 3:53165665-53165687 GGAATGGGGTCTCCAGCTCCAGG + Intronic
956694121 3:71904234-71904256 GGACTGGGGTGTGCTGCCACAGG + Intergenic
959940304 3:112074166-112074188 GGATTGGTATTTGCTGCTCTGGG - Intronic
960707722 3:120496407-120496429 GGATGGGGTTGGGCTTCTCCTGG - Intergenic
965165843 3:165194111-165194133 GGATTGGTGTGTGCTGGTGGGGG - Intronic
965984540 3:174735988-174736010 GCAGTGGGGTGGGCAGCTCCAGG + Intronic
966937091 3:184717764-184717786 GTAATTGGGGGTGCTGCTCCGGG + Intergenic
1202741923 3_GL000221v1_random:63643-63665 GCAGTGGGGTGGGCAGCTCCAGG - Intergenic
969194287 4:5548036-5548058 GCAATGGGGTGGGCAGCTCCAGG - Intronic
969669485 4:8581884-8581906 GCTGTGGGGTGTGCTTCTCCGGG + Intronic
972584467 4:40424607-40424629 GGATTGGGGTGTGCACATCCAGG - Exonic
973004497 4:44991011-44991033 GGAAAAGGGTGTGCTGGTCCTGG - Intergenic
978545965 4:109873051-109873073 TGATTTGGATGTGCTGCTCATGG - Intergenic
978940879 4:114434810-114434832 GGAATGGGGTGTGCTTATACTGG + Intergenic
980007710 4:127560132-127560154 GCAGTGGGGTGGGCAGCTCCAGG - Intergenic
980100742 4:128539149-128539171 GGATGGGGGTGTGGTGGGCCAGG + Intergenic
980485385 4:133450867-133450889 GGATGGGGGTGTGGTGGGCCAGG - Intergenic
987312060 5:16690573-16690595 GGAGTGGGGGCTGCTGCCCCTGG - Intronic
989558563 5:42825396-42825418 GGATGGGGGTGTGGTGGGCCAGG - Intronic
997251122 5:132389439-132389461 GAAGTGGGATGTGCTCCTCCTGG + Intronic
1001526053 5:172429635-172429657 GGGGTGGGGTGTGCTGAGCCAGG + Intronic
1002567212 5:180118882-180118904 GGGTTGGAGAGGGCTGCTCCTGG + Intronic
1004705610 6:18121728-18121750 GGACTGGGGTTTGCAGCACCAGG - Exonic
1005862621 6:29913153-29913175 GTATTGGGGTCTGCTCCTCAGGG + Intergenic
1008879093 6:56362722-56362744 GGAGTGGGGAGGGCTGATCCAGG - Intronic
1014384833 6:120786883-120786905 GCAGTGGGGTGGGCAGCTCCAGG - Intergenic
1017253720 6:152309855-152309877 GGATGGCGGTGTGCTGCAGCCGG + Exonic
1017396132 6:154002186-154002208 GCAGTGGGGTGGGCAGCTCCAGG + Intergenic
1018060819 6:160088276-160088298 GTATTGGGCGGGGCTGCTCCAGG + Intronic
1019556574 7:1634399-1634421 GGGTTGGGGTCAGCTGCCCCGGG + Intergenic
1019580690 7:1760607-1760629 GCATTAGGGTGGGCAGCTCCAGG + Intergenic
1021658745 7:22897679-22897701 GCAGTGGGGTGAGCTCCTCCTGG + Intergenic
1022515378 7:30971893-30971915 GGATTCTGGTGTGCTGCAACTGG - Intronic
1022849315 7:34243986-34244008 GGATTGGAGTGTGAAACTCCAGG + Intergenic
1023699918 7:42882807-42882829 GCAGTGGGGTGGGCAGCTCCAGG + Intergenic
1024113668 7:46172471-46172493 GGAGTGGGGTGTAGTGGTCCAGG + Intergenic
1030739852 7:113095719-113095741 GGGGTGTGGTGTGCAGCTCCAGG + Intergenic
1032018001 7:128392136-128392158 GGGTGGGGGTGTGCTGGTGCAGG - Intergenic
1032094655 7:128932030-128932052 GGCTTTGGAGGTGCTGCTCCAGG + Intergenic
1032222802 7:130007219-130007241 GCATGGGGGGGTGCTCCTCCAGG - Intergenic
1032779838 7:135156722-135156744 TGATTGGGATCTGCTGCTGCTGG + Intronic
1035309330 7:157955127-157955149 GCATTCGTGTGTGCTGCTCCTGG - Intronic
1037910176 8:22739577-22739599 GGCTTGGGGAGTGGTGCCCCAGG + Intronic
1038437718 8:27548039-27548061 GCAGTGGGTTGTGCTGCTCCCGG + Intergenic
1041225902 8:55697820-55697842 GGATTGGGGACTCCTGATCCTGG + Intronic
1042823746 8:72959747-72959769 GGATTGGGGCCAGCTGCTTCAGG - Intergenic
1045942461 8:107755145-107755167 GGATGGGGGTGTGGTGGGCCAGG - Intergenic
1048329572 8:133462788-133462810 GCATTGGGTTGTGCTGCCTCAGG - Intronic
1049582718 8:143420161-143420183 GGAGTGGGATGTGCCTCTCCAGG - Intronic
1049705872 8:144041726-144041748 GGTTGGGGGTGTGCGGCTGCTGG + Intronic
1049747884 8:144270673-144270695 GGATTCGGGTGGGCTGCCGCAGG - Intronic
1050899875 9:10933705-10933727 GGATTAGGGTATAATGCTCCTGG + Intergenic
1050900887 9:10947373-10947395 GGATGGGGGTGTGGTGAGCCAGG + Intergenic
1051214263 9:14779433-14779455 GCATTTGGGTTTGTTGCTCCTGG - Intronic
1052691559 9:31821695-31821717 GCAGTGGGGTGGGCAGCTCCAGG - Intergenic
1053025491 9:34725335-34725357 GGCTAGGGCTGTGCTGCTGCTGG + Exonic
1053037020 9:34834397-34834419 GGCTAGGGCTGTGCTGCTGCTGG + Intergenic
1053248618 9:36555997-36556019 TGATTGGGGTCTGCTGCCACCGG + Intergenic
1054906934 9:70420356-70420378 GGTTGGGGGTGTGCTGCGGCGGG - Intergenic
1055734419 9:79312329-79312351 GGATGGGGGTGTGGTGGGCCAGG - Intergenic
1057186426 9:93059696-93059718 GGAGTGGGGTGGGCTGGACCAGG + Intronic
1058790294 9:108438014-108438036 GGCTAGGGGTGGGCTGCTCCAGG + Intergenic
1060072276 9:120560451-120560473 GGAATGGTCTGTGCTGATCCTGG + Intronic
1061779852 9:132989168-132989190 GGACGTGCGTGTGCTGCTCCAGG - Exonic
1062083186 9:134635263-134635285 GGATTGGCGTGTCATCCTCCAGG - Intergenic
1062329236 9:136029756-136029778 GCAGTGGGGTGGGCAGCTCCAGG - Intronic
1062363071 9:136196723-136196745 GGATTGGGGAAAGCTTCTCCCGG + Exonic
1062598309 9:137309011-137309033 GGAGTGAAGGGTGCTGCTCCTGG - Intronic
1203691512 Un_GL000214v1:47207-47229 GCAGTGGGGTGGGCAGCTCCAGG + Intergenic
1203751873 Un_GL000218v1:87592-87614 GCAGTGGGGTGGGCAGCTCCAGG - Intergenic
1203710553 Un_KI270742v1:93567-93589 GCAGTGGGGTGGGCAGCTCCAGG - Intergenic
1203644783 Un_KI270751v1:56984-57006 GCAGTGGGGTGGGCAGCTCCAGG - Intergenic
1185669429 X:1794572-1794594 GTAAAGGGGTGTGCCGCTCCAGG + Intergenic
1186123284 X:6385463-6385485 GGAAAGGGGTGGGCTGTTCCTGG + Intergenic
1187698061 X:21940722-21940744 GGCTGGGAGTGTGCTGCGCCCGG - Exonic
1190362953 X:49666428-49666450 GCATTCGAGTGTGCTGCTGCGGG + Intergenic
1190495594 X:51025704-51025726 GGGTGGGTCTGTGCTGCTCCTGG + Intergenic
1190510332 X:51167877-51167899 GGGTGGGTCTGTGCTGCTCCTGG - Intergenic
1191766631 X:64705425-64705447 GGATGGGGGTGTGGTGGGCCAGG + Intergenic
1195223581 X:102769363-102769385 TGAGTGTGGTGTCCTGCTCCAGG + Intergenic
1195300396 X:103524559-103524581 TGAGTGGGGTGTCCTGCTCCTGG - Intergenic
1195303386 X:103554730-103554752 TGAATGTGGTGTCCTGCTCCAGG - Intergenic
1198115950 X:133544872-133544894 GGATGGGGTTGTTCTGTTCCTGG - Intronic
1201165530 Y:11205212-11205234 GCAGTGGGGTGGGCAGCTCCAGG - Intergenic