ID: 1121602320

View in Genome Browser
Species Human (GRCh38)
Location 14:95214583-95214605
Sequence CTCAAGCGACCCTGCCGCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 7103
Summary {0: 1, 1: 1, 2: 24, 3: 545, 4: 6532}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121602316_1121602320 3 Left 1121602316 14:95214557-95214579 CCAGGGCTGATGTTGGAACTCCT 0: 1
1: 1
2: 6
3: 59
4: 259
Right 1121602320 14:95214583-95214605 CTCAAGCGACCCTGCCGCCATGG 0: 1
1: 1
2: 24
3: 545
4: 6532

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121602320 Original CRISPR CTCAAGCGACCCTGCCGCCA TGG Intronic
Too many off-targets to display for this crispr