ID: 1121602805

View in Genome Browser
Species Human (GRCh38)
Location 14:95218606-95218628
Sequence AGGGCCCACTGAGTATTTTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 118}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121602799_1121602805 25 Left 1121602799 14:95218558-95218580 CCTGTTGGGGACAGTGGGCTGAA 0: 1
1: 0
2: 0
3: 8
4: 129
Right 1121602805 14:95218606-95218628 AGGGCCCACTGAGTATTTTGTGG 0: 1
1: 0
2: 1
3: 8
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121602805 Original CRISPR AGGGCCCACTGAGTATTTTG TGG Intronic
906089969 1:43170788-43170810 GCGACCCACTGATTATTTTGCGG - Exonic
906555061 1:46704070-46704092 AGGTCCAAATGAGTATTGTGAGG - Intronic
908612087 1:65873394-65873416 AGGGATCACTGAATATTTTTAGG + Intronic
910170332 1:84370305-84370327 AGGGCCCAGTGGGCATTTTAGGG + Intronic
910483399 1:87683296-87683318 AGGGACCATTGACTATTCTGGGG - Intergenic
911507507 1:98771841-98771863 AGGGCCCACTGTATAATGTGTGG - Intergenic
916234891 1:162577216-162577238 AGAGCTCACTGAGTACTTTAAGG - Intronic
917930335 1:179818312-179818334 AGGACCCACTGATTATTTCCAGG - Intergenic
918432065 1:184471347-184471369 AGGGCCTCCTGAAAATTTTGAGG + Intronic
919480299 1:198079766-198079788 AGGGCCCACTGTGTTTACTGGGG + Intergenic
1064013834 10:11757959-11757981 CAGGCCCACCGAGTATTTTGGGG + Intronic
1066787595 10:39022770-39022792 GGAGCCCACTGAGGCTTTTGGGG - Intergenic
1066790774 10:39060687-39060709 GGGGCCCACTGAGGCTTATGGGG - Intergenic
1070530662 10:77334246-77334268 AGAGTTCACTGAGCATTTTGTGG + Intronic
1072437420 10:95426906-95426928 AGGGCCAACTGAGAAGTTGGAGG - Intronic
1072574311 10:96686339-96686361 AGGGCCCACATATTATTCTGTGG - Intronic
1076440527 10:130478457-130478479 AGTGCCTGCTGAGTATTTTAAGG + Intergenic
1078017768 11:7629929-7629951 AGGGCCCTCTGAGTCTGCTGCGG - Intronic
1078935449 11:15945442-15945464 AGGGCACATGGGGTATTTTGGGG + Intergenic
1081904290 11:46657450-46657472 GGGGCCCTCTGAGGACTTTGTGG + Intronic
1085081179 11:73635391-73635413 AGAGCCCAAGGAGTGTTTTGAGG + Intergenic
1086793742 11:91073718-91073740 AGAACCCACTGATTATTATGGGG + Intergenic
1092681008 12:10981313-10981335 ATGGACCACTGTGTCTTTTGGGG - Intronic
1102143424 12:110635967-110635989 AGGGCCCACTGAGAAACGTGGGG - Intronic
1102176110 12:110876186-110876208 AGGCCCCACTGAGTAGGTGGAGG - Intronic
1103992565 12:124809106-124809128 AACACCCACTGAGTATTTGGAGG + Intronic
1107191204 13:37588839-37588861 AGGAACCACTGAAGATTTTGTGG + Intronic
1108207087 13:48101334-48101356 AGGACCCACTGAAGATTTGGGGG - Intergenic
1110218444 13:73048550-73048572 AGGGCACAATAAATATTTTGGGG - Intergenic
1112440764 13:99423152-99423174 AGGGCCCATGGAGTATGATGGGG + Intergenic
1119480197 14:74954095-74954117 AGGGTCCAGTGAGTTTTTAGTGG - Intronic
1119545389 14:75468027-75468049 TGGGCCCACTGAGGGTTCTGGGG + Intronic
1120886535 14:89456219-89456241 AGGGCCCACGGGCTCTTTTGTGG - Intronic
1121202158 14:92127208-92127230 AGAGAGCACTAAGTATTTTGAGG + Intronic
1121602805 14:95218606-95218628 AGGGCCCACTGAGTATTTTGTGG + Intronic
1121666425 14:95675968-95675990 AGGGCCCAGAGAGTATTTGTTGG - Intergenic
1121972617 14:98372358-98372380 GAGACCCACTGAGGATTTTGGGG + Intergenic
1122168862 14:99854031-99854053 AGGTCTCACTCAGTATGTTGAGG + Intronic
1127976211 15:63999046-63999068 AGCGCCTACTGTGTACTTTGTGG - Intronic
1128615002 15:69102104-69102126 AGGGGCTACTTGGTATTTTGTGG - Intergenic
1132041057 15:98524942-98524964 AGAGTCCACTGAGTTCTTTGAGG - Intergenic
1134012742 16:10867305-10867327 AGAGCCCACTGTGTGTGTTGGGG + Intergenic
1136294588 16:29294451-29294473 AGGACCGGCTGAGTATTTTGTGG + Intergenic
1138645415 16:58421005-58421027 AGGGCCCTCTGGGTAGTCTGTGG + Intergenic
1139709524 16:68765131-68765153 TGGGCCAACTGAGAATTTTGGGG + Intronic
1141716735 16:85731227-85731249 AGGAACCACTGTGTAATTTGTGG + Intronic
1142100493 16:88268495-88268517 AGGACCGGCTGAGTATTTTGTGG + Intergenic
1143137766 17:4721194-4721216 AGGGTCCAGTGTGTATCTTGGGG - Exonic
1146115905 17:30138661-30138683 AGGGCCAACTGTATACTTTGGGG + Intronic
1148779677 17:50114243-50114265 AGGGCCCACTGGGGATCTTGGGG + Exonic
1149919307 17:60641840-60641862 AAGGACCACTGAGTGTCTTGTGG + Intronic
1150013276 17:61526556-61526578 AAGGACTACTGTGTATTTTGAGG - Intergenic
1150120697 17:62599354-62599376 ATGGGCCACTGAGCAATTTGAGG - Intronic
1152284582 17:79404670-79404692 TGGGCCCAGTGAGTGATTTGAGG - Intronic
1155587581 18:27385180-27385202 AGTGTAGACTGAGTATTTTGTGG + Intergenic
1161900414 19:7114527-7114549 AGGGACCAGTAAGAATTTTGAGG - Intronic
1163535657 19:17874768-17874790 CGGGCCCACTGTGTCTCTTGTGG + Intronic
1165585112 19:36908295-36908317 AGGGCACACTCTGAATTTTGGGG + Intronic
1166426728 19:42685567-42685589 AGGGGCCACTGTCAATTTTGAGG + Intronic
1167453077 19:49583681-49583703 AGAGGCCAGGGAGTATTTTGAGG + Exonic
925355307 2:3236830-3236852 AGGGCTGACTCAGTATCTTGAGG + Intronic
925665329 2:6248586-6248608 TGTGCCCACTGAGTATATTATGG + Intergenic
925901741 2:8513879-8513901 AGGGCCCACTGGGGATGCTGAGG + Intergenic
926902156 2:17763975-17763997 AGGGACTACTGAGTATGGTGGGG - Intronic
926984683 2:18610047-18610069 AGGGCACATTGAGTTTTTGGAGG + Intergenic
930897184 2:56460115-56460137 AAGGCCTATTGAGTATTGTGGGG + Intergenic
931246604 2:60497775-60497797 AGAGGCCACTGAGTCCTTTGGGG - Intronic
931596233 2:63947799-63947821 AGGGCCCATGGAGTATTTATTGG - Intronic
932819149 2:74884860-74884882 AGGGGCCACTGAGGATGCTGAGG + Intronic
935387821 2:102519781-102519803 AAGGCCCACTGATAGTTTTGTGG + Intronic
938761825 2:134433052-134433074 AGGGACAAATGAGTTTTTTGGGG - Intronic
940001574 2:148971744-148971766 AGGCCCCATGTAGTATTTTGTGG + Intronic
940627457 2:156193242-156193264 TGGGCCCAATGAGTCTGTTGTGG + Intergenic
942796810 2:179830557-179830579 AAGTCCCACTAAGTCTTTTGTGG - Intronic
942917719 2:181331749-181331771 AGAGGCCTCTGAGTATTTTCAGG + Intergenic
948472706 2:238195111-238195133 CAGGGCCACTGAATATTTTGAGG + Intronic
1174129020 20:48328697-48328719 AGGGGACACTGAGTCTTTGGTGG + Intergenic
1175246174 20:57583488-57583510 AGGGGCCACTGAGCATTTCAAGG - Intergenic
1175963203 20:62647456-62647478 AGGCCCCACTCAGAATTTGGAGG - Intronic
1177414727 21:20779061-20779083 AGGGCCCATGGAGCATTTAGAGG - Intergenic
1178088095 21:29133238-29133260 AAGGGCCTCTGAGTATTTAGGGG + Intronic
1179462169 21:41543782-41543804 CTGGCACACTGAGTATTTTAAGG + Intergenic
1179602572 21:42490033-42490055 AGGGCCAACTGAGGACTCTGAGG - Intronic
1180887444 22:19257039-19257061 TGGGCCTATTGAGTTTTTTGAGG - Intronic
1181887636 22:26034193-26034215 AGGGCCCACTGCATAATTTCTGG - Intergenic
1183073384 22:35411606-35411628 AGGGGCCACTGAGGGTTTTCAGG + Intronic
949596691 3:5555139-5555161 AGGGCCCACTTACTGGTTTGTGG - Intergenic
954519090 3:51207322-51207344 AGGTACCAGTGAGTATTTTATGG + Intronic
961683901 3:128616835-128616857 AGGGCGCACTGGGTCCTTTGGGG + Intergenic
964642704 3:158927309-158927331 AGGGCCCAATGTGCATTTTGAGG - Intergenic
972334546 4:38095688-38095710 AGAGCCAACAGAGTATGTTGGGG + Intronic
972922518 4:43961553-43961575 GGAGCTCAATGAGTATTTTGGGG - Intergenic
983155011 4:164336407-164336429 AGGGACCTCTGAGTTCTTTGAGG - Intronic
986811680 5:11366377-11366399 AAAAACCACTGAGTATTTTGAGG + Intronic
990729510 5:58793144-58793166 AGGGCCCACTGAGAGGTTTGAGG - Intronic
991953474 5:71969743-71969765 AGGGCTCACTGACTAATCTGGGG + Intergenic
994195617 5:96919902-96919924 AAGGCCCATTGAGAATTATGTGG + Intronic
995670481 5:114597432-114597454 AAGGCTCACTGAGTACTTTGTGG - Intergenic
999592558 5:153164528-153164550 AAGGCCCACTGAGTATATCAAGG - Intergenic
1000209547 5:159097234-159097256 AGCGCCCACTGGATGTTTTGGGG - Intronic
1013781858 6:113737697-113737719 AGGGAACAATGAGTTTTTTGGGG - Intergenic
1015166781 6:130207766-130207788 AGGGCCCACTGACTCTTGTTTGG - Intronic
1015221672 6:130811339-130811361 TGGTCTCACTGAGTATTTGGAGG - Intergenic
1018160591 6:161038384-161038406 TTGGCCCCCTCAGTATTTTGAGG + Intronic
1023055024 7:36284176-36284198 AGAGCCCACTCAGTGTTTTCTGG - Intronic
1023138142 7:37074656-37074678 AGGGCCCCCAGAGTTTTGTGTGG + Intronic
1026002299 7:66570035-66570057 AGGGCCCCTTCAATATTTTGGGG - Intergenic
1026029550 7:66778721-66778743 AGGGCCCCTTCAATATTTTGGGG + Intronic
1026380787 7:69797402-69797424 AGTGCCCACTCAGTATTTCTGGG + Intronic
1027214248 7:76173789-76173811 AGGGCCCACTGTGTATGTCATGG + Intergenic
1032730608 7:134638491-134638513 AGGGCTCACAGAGTATTTTGGGG - Intergenic
1033783331 7:144699071-144699093 AAGGCCCACTGTGAATTTTTGGG - Intronic
1039121590 8:34153804-34153826 GGGACCCACTGAGAATATTGTGG + Intergenic
1040747248 8:50660135-50660157 AGGGCGAACTGTGTATTTTTAGG + Intronic
1051361227 9:16283400-16283422 AGGGCTCACTGAGTCTCTGGAGG + Intergenic
1051635810 9:19179994-19180016 AAGTCCCACTGAAGATTTTGAGG + Intergenic
1055929848 9:81548923-81548945 AGGGTTTAGTGAGTATTTTGGGG - Intergenic
1058963669 9:110016426-110016448 AGGCCCCACTGTGCATTGTGAGG + Intronic
1059112735 9:111572129-111572151 AGTTCCCACTGATTACTTTGAGG + Intronic
1060225599 9:121788573-121788595 AGGTCCCCCTGTGTGTTTTGTGG + Intergenic
1185480120 X:439463-439485 CCGGGGCACTGAGTATTTTGGGG + Intergenic
1191737879 X:64406610-64406632 AGAACTCACTGACTATTTTGAGG + Intergenic
1192103070 X:68286352-68286374 AGGGCTCTCTGTGTATTGTGGGG + Intronic
1192637797 X:72836376-72836398 AGGGGCCACAGAGTTTTCTGAGG - Intronic
1192643917 X:72884439-72884461 AGGGGCCACAGAGTTTTCTGAGG + Intronic
1195020822 X:100826043-100826065 AGGGACTACTCAGTTTTTTGGGG + Intronic
1197659107 X:129150598-129150620 AGGATCCACTGGGTAATTTGTGG - Intergenic
1197966567 X:132069344-132069366 AGGTTCCACAGACTATTTTGTGG + Intergenic