ID: 1121603411

View in Genome Browser
Species Human (GRCh38)
Location 14:95222947-95222969
Sequence CTAAAACAGAGGTGCAGCAA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 219
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 208}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121603411_1121603414 -10 Left 1121603411 14:95222947-95222969 CCGTTGCTGCACCTCTGTTTTAG 0: 1
1: 0
2: 0
3: 10
4: 208
Right 1121603414 14:95222960-95222982 TCTGTTTTAGTTAGGCACAATGG 0: 1
1: 0
2: 0
3: 14
4: 156
1121603411_1121603416 0 Left 1121603411 14:95222947-95222969 CCGTTGCTGCACCTCTGTTTTAG 0: 1
1: 0
2: 0
3: 10
4: 208
Right 1121603416 14:95222970-95222992 TTAGGCACAATGGGTTGCCAAGG 0: 1
1: 0
2: 0
3: 5
4: 83
1121603411_1121603421 29 Left 1121603411 14:95222947-95222969 CCGTTGCTGCACCTCTGTTTTAG 0: 1
1: 0
2: 0
3: 10
4: 208
Right 1121603421 14:95222999-95223021 CAAACAGTGGACTCTGGAACAGG 0: 1
1: 0
2: 0
3: 18
4: 168
1121603411_1121603420 23 Left 1121603411 14:95222947-95222969 CCGTTGCTGCACCTCTGTTTTAG 0: 1
1: 0
2: 0
3: 10
4: 208
Right 1121603420 14:95222993-95223015 CCAAATCAAACAGTGGACTCTGG 0: 1
1: 0
2: 1
3: 12
4: 153
1121603411_1121603417 16 Left 1121603411 14:95222947-95222969 CCGTTGCTGCACCTCTGTTTTAG 0: 1
1: 0
2: 0
3: 10
4: 208
Right 1121603417 14:95222986-95223008 GCCAAGGCCAAATCAAACAGTGG 0: 1
1: 1
2: 0
3: 8
4: 110
1121603411_1121603415 -9 Left 1121603411 14:95222947-95222969 CCGTTGCTGCACCTCTGTTTTAG 0: 1
1: 0
2: 0
3: 10
4: 208
Right 1121603415 14:95222961-95222983 CTGTTTTAGTTAGGCACAATGGG 0: 1
1: 0
2: 0
3: 3
4: 109

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121603411 Original CRISPR CTAAAACAGAGGTGCAGCAA CGG (reversed) Intronic
907988830 1:59558912-59558934 CTAAAACAGATGTGCAGGTAGGG - Intronic
908495343 1:64688965-64688987 CTAAAACAGAGGCACACAAAAGG - Intronic
909106530 1:71416789-71416811 CAAATACAAAAGTGCAGCAAAGG - Intronic
911285531 1:95987611-95987633 GTAAGACAGAGGAGCAGAAAGGG - Intergenic
913451941 1:118998600-118998622 CCCAGACAGAGGTGCAGCCAAGG - Intergenic
921636449 1:217500413-217500435 GGAAACAAGAGGTGCAGCAAAGG - Intronic
921797583 1:219365081-219365103 ATACAACAGTGCTGCAGCAAAGG + Intergenic
1063364195 10:5479968-5479990 CGAAGACACAGGTGCAGCCACGG + Intergenic
1063381018 10:5585930-5585952 CCAAAACAGATTTGGAGCAATGG + Intergenic
1064698619 10:17993644-17993666 TGAAAACAGATGTGGAGCAAGGG + Intronic
1064803867 10:19109017-19109039 CTAAAGCACAGGTGTAGTAAAGG - Intronic
1066325586 10:34354738-34354760 CTAGAGCAGAGGTGCTGCAGGGG + Intronic
1066669317 10:37820312-37820334 CTGAAACAGAAGTGAAGCACAGG + Intronic
1068150857 10:53129011-53129033 ATAAAACAGAGGTGGGGGAAGGG - Intergenic
1068516926 10:58036599-58036621 CTCCAGCAGAGGTGCAGCAGAGG - Intergenic
1069297961 10:66870783-66870805 CATAAACAAATGTGCAGCAAAGG - Intronic
1069660782 10:70122182-70122204 CAAAAACAGAGCTGCTCCAATGG + Intronic
1070352468 10:75606377-75606399 TTAAAACAAAGGTGCAGTGAAGG + Intronic
1071488559 10:86120274-86120296 AGAAAACAGTGGGGCAGCAAGGG - Intronic
1075180829 10:120209478-120209500 GTAAAACACAGCTGCAGGAAAGG - Intergenic
1076127015 10:127983131-127983153 CTAAAAAAGAGGGCCAGCCAGGG - Intronic
1078911682 11:15738624-15738646 CTAAGAGAGAGGTGCAAGAAAGG + Intergenic
1079602062 11:22321735-22321757 CAAGAACAGAGGTGGAGCTAAGG + Intergenic
1080480841 11:32648200-32648222 CGAAATCAAAGGTGCAGAAATGG - Intronic
1081906400 11:46673091-46673113 CTATAACCAAGGAGCAGCAACGG - Intronic
1087679278 11:101201083-101201105 CCAAAGCAGTGGAGCAGCAATGG + Intergenic
1091250694 11:134141563-134141585 CTGAAACATAGATGCAGCCACGG - Intronic
1091867341 12:3852017-3852039 CTCCAACAGACGTGCAGCAGAGG + Intronic
1095458481 12:42415638-42415660 CTAATACAGTGGTGAAGCCATGG - Intronic
1097391204 12:59016111-59016133 TTAAAACAGAGAGGCAGTAAGGG - Intergenic
1097509677 12:60522033-60522055 ATAAAACAGAGAAGCAGAAATGG - Intergenic
1097599071 12:61669801-61669823 CTAATACAGGGGGTCAGCAAAGG - Intergenic
1100885385 12:99064333-99064355 GTAAAATAGAAGTGAAGCAATGG + Intronic
1101229608 12:102726652-102726674 CAACAACAGATGTACAGCAATGG + Intergenic
1101266628 12:103095081-103095103 TTAAAACAGAGTAGCAGCAGAGG - Intergenic
1102209263 12:111112778-111112800 ATAAAACACAGGAGAAGCAAGGG - Intronic
1103034075 12:117642135-117642157 CTACAACAGGGGAGCAGCAATGG - Intronic
1103038294 12:117674019-117674041 CTAACACAGATGTGCAGCCTTGG - Intronic
1103431128 12:120887684-120887706 CTAAAACAGAGGTTCAACTTTGG + Intronic
1104829922 12:131743408-131743430 CCAAAACAGAGGGGCTGCACAGG + Intronic
1108593373 13:51929954-51929976 CTGAGACAGAGGTGCTGCAGTGG - Intergenic
1109656131 13:65392885-65392907 TTAAGACAGAGGTGAAGCAGCGG + Intergenic
1110542578 13:76722632-76722654 CTAAATAAGAGGAGAAGCAATGG - Intergenic
1114127291 14:19743709-19743731 ATCAAACAGAGGAGCAGGAAGGG - Intronic
1115176554 14:30568544-30568566 CTAAAAAATATGTGCAGAAAAGG - Intronic
1116369224 14:44108766-44108788 CTTTAACACATGTGCAGCAAGGG + Intergenic
1117167354 14:53050083-53050105 ACAAAACAGAGGTACAGTAAAGG + Intronic
1118984353 14:70740932-70740954 GAAAAACAAATGTGCAGCAAGGG + Intronic
1119047763 14:71335455-71335477 CTAAATCAGAGGACCTGCAATGG - Intronic
1119948049 14:78715317-78715339 CTAAGACTGAGTTGCAGAAAGGG + Intronic
1120144185 14:80961394-80961416 CTTAAACTGAGGTTCAGCGAAGG + Intronic
1121603411 14:95222947-95222969 CTAAAACAGAGGTGCAGCAACGG - Intronic
1125194801 15:37033976-37033998 CTACAAGGGAGGTGCAGAAAAGG + Intronic
1127637050 15:60881140-60881162 CAATAAGAAAGGTGCAGCAAGGG - Intronic
1128329271 15:66745172-66745194 TCAAAACAGAGGGGCAGCCAGGG - Intronic
1135848258 16:25938925-25938947 CTAAACCAGACGTTCTGCAAGGG + Intronic
1137692225 16:50436841-50436863 CTAAAACAGATGTGCTGAATTGG - Intergenic
1137727792 16:50668805-50668827 CCAAAACAGAGTTCCAGCTATGG + Intronic
1137797800 16:51237024-51237046 CCCAAACAGAGATGCAGCTAGGG - Intergenic
1139393972 16:66625115-66625137 TAAAAACAGAGATGCAGCAAAGG + Intronic
1141509028 16:84500750-84500772 CTGAAACAGAGGGGCTGCACCGG + Intronic
1141717366 16:85734619-85734641 GTAAAGAAGAGGGGCAGCAATGG + Intronic
1145990553 17:29076969-29076991 CTTAAAAAGAGGTGAGGCAATGG - Exonic
1146886903 17:36476981-36477003 CAAAAAAAAAGGTGTAGCAAAGG - Intergenic
1147006607 17:37408235-37408257 CAAAAACAGACGTCCAGTAAAGG - Intronic
1147201660 17:38806320-38806342 CTAAAAAAGAGGTCTACCAAAGG - Exonic
1148355437 17:46972466-46972488 CCAAAGCTGAGGTTCAGCAAGGG - Intronic
1148921799 17:51042764-51042786 TTAAAAATGAGGTGAAGCAAAGG + Intronic
1153358329 18:4163807-4163829 GGAAAAGAGAGGTGCAGAAAAGG - Intronic
1156877344 18:42030882-42030904 CTAAAACTGAGGTGTTGCCAAGG - Intronic
1156903414 18:42327319-42327341 CTAAACCAGAGTGGTAGCAATGG - Intergenic
1159209894 18:65305043-65305065 ATAAAACAGAGGTGGGGAAAAGG - Intergenic
1160268958 18:77366541-77366563 CTGAATCACTGGTGCAGCAAAGG - Intergenic
1161058506 19:2202329-2202351 CAAAAACAGAGGCCCAGCACGGG - Intronic
1161579442 19:5072784-5072806 CTAAAACCCAGGTGCAGGCAGGG + Intronic
1163101646 19:15100930-15100952 CTGAAACTGAGGTGCAGGAGGGG - Intergenic
1165482425 19:36072539-36072561 ATAAAACAGACTTGCAACAAAGG - Intronic
925246477 2:2388132-2388154 CTAATACAGACGTGAAGGAAGGG - Intergenic
925719947 2:6817468-6817490 ATAAAACAGAGGTGCGGGAGAGG - Intergenic
927012133 2:18914862-18914884 CAAAAACAGAGGAGCAGTCATGG - Intergenic
928912884 2:36440573-36440595 CTAAAATTGAGATACAGCAATGG + Intronic
933234433 2:79849657-79849679 GCAAAACAGAGGAGAAGCAAAGG + Intronic
933310866 2:80660121-80660143 CTAGAGAAAAGGTGCAGCAATGG - Intergenic
934850518 2:97697421-97697443 CTTCCACAGAGCTGCAGCAATGG - Intergenic
937064931 2:119010799-119010821 GGAAAACAGAGGTGCGGCACAGG - Intergenic
937383967 2:121408822-121408844 CTAAAACAGATGTACATGAAAGG + Intronic
940529276 2:154859497-154859519 TTAAAACACTGGTTCAGCAAGGG - Intergenic
942489354 2:176474349-176474371 CTAAAGCAAACGAGCAGCAAGGG + Intergenic
943078165 2:183223735-183223757 CTAAAGCAGAGGTGAGCCAAGGG + Intergenic
943645708 2:190406850-190406872 CTAAAACTCAAGTGGAGCAAAGG + Intergenic
947060367 2:226157610-226157632 ATAAAACATAGCTGAAGCAATGG - Intergenic
947959245 2:234221266-234221288 CTGCATCAGAGGAGCAGCAATGG - Intergenic
1170379715 20:15743681-15743703 CTCAAACACAAGTGCAGCGAGGG - Intronic
1171993456 20:31714378-31714400 CTACAACAGAAATGCTGCAAGGG + Intronic
1172541603 20:35721850-35721872 AAAAAACAGAGCTGCAGCAATGG - Exonic
1173580095 20:44141033-44141055 TGAAAACAGAGGTGCAGTGAAGG + Intronic
1174843076 20:53918004-53918026 CTAAATCAGGGGTGCAGCACTGG - Intergenic
1175131351 20:56791981-56792003 CTATAACAGGTGTGCAGCTACGG - Intergenic
1175615388 20:60393942-60393964 TTCAGACAGAGGTGCAGCAGGGG + Intergenic
1178254026 21:31034240-31034262 TTAAAACAGAAATGGAGCAAGGG + Intergenic
1181371255 22:22419151-22419173 GTAAAACTTATGTGCAGCAAAGG + Intergenic
1184903359 22:47461785-47461807 CAAGAACAGAGGTGCAACTAAGG - Exonic
951253192 3:20418080-20418102 CTACTACAGAGCTTCAGCAATGG - Intergenic
953157900 3:40391776-40391798 CTAAAACAGTGTTGCAGGGAGGG - Intronic
953500934 3:43433413-43433435 CTCAAACTGAAGTGCAGCACAGG - Intronic
953699578 3:45185415-45185437 CTGAAAGAGAGGTGCTGCCAAGG + Intergenic
954870482 3:53763874-53763896 CTATAACATATCTGCAGCAAGGG - Intronic
954999423 3:54913289-54913311 CTAAAGCAGAAGTGCAGCCTTGG - Intronic
955597450 3:60607013-60607035 CAAATATAGAGGTCCAGCAATGG - Intronic
955935640 3:64099955-64099977 TTAATACAGATGTGCAGCAATGG + Intronic
956268872 3:67428356-67428378 CTACAACAGACCTGCAGCTAAGG + Intronic
958800009 3:98744318-98744340 CTAATACAGAGGTTCTGCCATGG + Intronic
959364148 3:105435702-105435724 CTAATACACAAGTGAAGCAATGG - Intronic
959690730 3:109195042-109195064 CTAGCACAGAGGAGCAGAAACGG + Intergenic
961304801 3:125951071-125951093 CTCAAACAGAAGTGCAGCCCTGG - Intergenic
962742445 3:138371770-138371792 GTTAAACACAGGTGCAGCTAGGG - Intronic
964939829 3:162144252-162144274 CTTAAACAGAGATTCAGCACCGG + Intergenic
966258890 3:177951405-177951427 CTGAAAAATAGGTTCAGCAATGG - Intergenic
966493822 3:180557186-180557208 CTACAACAGACCTGCAGCAGAGG + Intergenic
966548285 3:181176301-181176323 TTAAAACATAGATGCAGCATTGG + Intergenic
966747942 3:183296167-183296189 CTAAACCAGAGGTGCAGACAAGG + Intronic
969210674 4:5684850-5684872 CTAGGACAGACGTGCAGCCAGGG + Intronic
970315469 4:14824905-14824927 CAAAGACAGAGGTACAGAAAGGG + Intergenic
972638716 4:40906854-40906876 CTAAAACAGAGGTGGCAGAAAGG + Intronic
972656674 4:41070191-41070213 CTAAAACAGACCTGCAACCAAGG - Intronic
973574406 4:52272251-52272273 TTAAAACTTTGGTGCAGCAAAGG + Intergenic
975431912 4:74303389-74303411 CCTCAACAGAGGTGCAGGAAGGG + Intergenic
975833131 4:78391135-78391157 CTATCACAGAGGTGCCCCAAGGG - Intronic
976238105 4:82922269-82922291 CTAAGAAAGAAGTACAGCAACGG - Intronic
976836343 4:89378955-89378977 TTAAAACAAAGTTGCAGAAATGG + Intergenic
977486581 4:97655315-97655337 CTATATTAGAGGTGCAGAAATGG + Intronic
977654956 4:99510110-99510132 CTAAAACATAGATGAAGCCAAGG + Intergenic
978950062 4:114547396-114547418 ATAAAACAGAGGTGAATGAAAGG - Intergenic
979365553 4:119818317-119818339 CTAAAACAGAGATGTAACATTGG - Intergenic
979993634 4:127405255-127405277 ATGAACCAGAGGTGAAGCAATGG - Intergenic
980584501 4:134794366-134794388 CCAAAACAGATATGCACCAATGG + Intergenic
981245966 4:142538428-142538450 CTAAAACACAGATGTAGTAACGG + Intronic
982196733 4:152923650-152923672 CCAAAACAGAGATACATCAATGG + Intergenic
983377560 4:166949567-166949589 CTCCAACAGACGTGCAGCTAAGG - Intronic
983423424 4:167550524-167550546 CAAAGACAAAAGTGCAGCAAAGG + Intergenic
983999775 4:174225819-174225841 CCAAAGCAGAGGAGCAGTAAAGG - Intergenic
985188062 4:187339118-187339140 CCAGAAGAGAGGAGCAGCAAAGG + Intergenic
985325660 4:188765997-188766019 CTAAATTAGATGTACAGCAAAGG + Intergenic
986448340 5:7842752-7842774 GTTAAACATAGGTGCACCAACGG - Intronic
986936106 5:12888969-12888991 CTATAATATGGGTGCAGCAATGG + Intergenic
988068414 5:26253382-26253404 CAAAAAAAGATGTGCAGAAAAGG - Intergenic
989404564 5:41045563-41045585 CTAAAAGTGAGGTGCAGAGAAGG + Intronic
990181654 5:53167360-53167382 TGAAAACAGAGGTACAGCATTGG - Intergenic
990915990 5:60906321-60906343 CTAAAACATAGGCCCAGCAGTGG - Intronic
991236793 5:64407790-64407812 CTCAAACAGACAGGCAGCAAAGG + Intergenic
992061600 5:73054502-73054524 CTAAAACAGAGATGCAAAATAGG - Intronic
992134046 5:73724534-73724556 CTACAACAAAGGGGCAGCACAGG - Intronic
994204539 5:97019669-97019691 CTAAAACACAAAGGCAGCAATGG - Intronic
995508846 5:112887663-112887685 CCAAAACTGAGGTCCACCAAAGG - Intronic
996270889 5:121603034-121603056 CTCCAACAGACGTGCAGCAGAGG + Intergenic
997039396 5:130233954-130233976 CTGGAACAGATGTGCAGCACTGG + Intergenic
997220256 5:132156682-132156704 CTACAACAGACCTGCAGCAGAGG - Intergenic
1000448593 5:161356491-161356513 CTAAAACAGATGTCCACCCAGGG - Intronic
1001788097 5:174431155-174431177 CTATAGCACAGGTGCAGCCAAGG + Intergenic
1002512045 5:179726749-179726771 CTAAAGCAGAGGTAAAGGAAAGG + Exonic
1003577863 6:7314039-7314061 CTATACAATAGGTGCAGCAATGG + Intronic
1004966356 6:20856172-20856194 CTAAAATACAGATGAAGCAATGG - Intronic
1005393066 6:25353321-25353343 ATAAAACTGAGGTGCAGACAGGG + Intronic
1007942399 6:45794272-45794294 CTAAAACAGAGGTGGGAAAAGGG + Intergenic
1008191013 6:48457241-48457263 CAAAAACAGTGGTGAAGCAGAGG + Intergenic
1009657316 6:66563654-66563676 GTAAAACAGAGTTCCATCAAAGG - Intergenic
1010313608 6:74418831-74418853 CTAAAACTTATGTACAGCAAAGG - Intergenic
1011503705 6:88018605-88018627 CTAAAAAAGAGATGCACAAATGG - Intergenic
1012228713 6:96735824-96735846 ATAAAAAAGAGTTGCAGGAAAGG - Intergenic
1015965837 6:138694114-138694136 GTAAAACAGAGGAGCAACCAGGG - Intergenic
1016236741 6:141877308-141877330 CAAAAACAGAGGTGCTGAACAGG + Intergenic
1016777783 6:147923986-147924008 CTAAAACAGAGATGCAGAAGAGG + Intergenic
1018252786 6:161888869-161888891 CTAAAAAAGAAATCCAGCAATGG - Intronic
1020818717 7:12939334-12939356 CTCCAACAGACGTGCAGCTAAGG - Intergenic
1021753391 7:23827821-23827843 CTACAACAGACCTGCAGCAGAGG - Intronic
1022092554 7:27117180-27117202 CCAAAACAGAGCTGTAGCCAGGG - Intronic
1022235669 7:28458066-28458088 CTAGAACAGAGGCTCAGAAACGG + Intronic
1022723553 7:32961495-32961517 CTAAAACAGGGGTACTGAAATGG + Intronic
1022812519 7:33883969-33883991 CTACAACAGAGTTGCACAAAAGG + Intergenic
1023683573 7:42713389-42713411 CAAAAACCAAGGTGCAGGAAGGG + Intergenic
1024366767 7:48529084-48529106 CTACCACACAGGTGCAGAAAGGG - Intronic
1024390468 7:48806064-48806086 CTAAAATAAAGGTGCTGGAAGGG + Intergenic
1025027217 7:55526502-55526524 CTAAAACAGAGCCGCACCACAGG + Intronic
1025050076 7:55726422-55726444 CTAAAACAGGGGTACTGAAATGG - Intergenic
1030286687 7:107834105-107834127 CGAAAACAGAGGATCAGAAAAGG + Intergenic
1031119250 7:117702562-117702584 CTAAAACAAAGGTGAAACACAGG - Intronic
1031500937 7:122515313-122515335 CTAGAGCAAAGGTGGAGCAAAGG - Intronic
1031808071 7:126330804-126330826 CTAAAAGAGAGCTTCAGGAATGG + Intergenic
1032203824 7:129844169-129844191 GTAAAACAGAAGAGCAGAAAAGG + Intronic
1033311462 7:140264886-140264908 CTTAAACAGGGGTGCAGGAGGGG + Intergenic
1035876343 8:3193898-3193920 CTGTAACAGAGGTGCAGTAAAGG - Intronic
1037535561 8:19820496-19820518 CTGAAACGGTGGTGCAGCATGGG + Exonic
1037677997 8:21068402-21068424 CTATGACACAGTTGCAGCAAAGG - Intergenic
1041109787 8:54473418-54473440 CTAAAGAAGAAGTGCAGCGATGG - Intergenic
1041312164 8:56527791-56527813 CTAAAACTGAGGTGAAGGCAAGG + Intergenic
1043707876 8:83376712-83376734 CTCAAAAAGAAGTACAGCAATGG - Intergenic
1048073881 8:131047830-131047852 CGAAAACAGGAGTGCAGCAGTGG - Intergenic
1049726755 8:144150121-144150143 CCACAACAGAGGTGCTGCACTGG - Intronic
1056333400 9:85540744-85540766 CTAAAACACTGGTGAAGCAAAGG + Intergenic
1060834563 9:126745356-126745378 TTAATACAGAGATGGAGCAAGGG + Intergenic
1186511836 X:10135415-10135437 CCAATTCAGAGGTGCAGGAAGGG - Intronic
1187784416 X:22867565-22867587 CTCCAGCAGACGTGCAGCAAAGG + Intergenic
1187923368 X:24227704-24227726 CAAAAATAGAGATCCAGCAATGG + Intergenic
1188913091 X:35874715-35874737 CTAAAACACAGAAGCAGCCAAGG + Intergenic
1189731936 X:44030023-44030045 AAAAAACAGAGCTGCAGCCATGG + Intergenic
1190545062 X:51517549-51517571 CTAAAACAGACCTGCAGCTGAGG - Intergenic
1192051867 X:67731868-67731890 AGAAAACCGAGGTCCAGCAAGGG - Intergenic
1194044313 X:88983063-88983085 CTACAACAGAATTGCAGCATGGG + Intergenic
1194064483 X:89244629-89244651 CTAAAACAAATATGGAGCAATGG - Intergenic
1194122390 X:89976737-89976759 TTAAAACAGAGATGAAGAAAAGG + Intergenic
1194203029 X:90978386-90978408 CTACAACAGACCTGCAGCAGAGG - Intergenic
1194783033 X:98048609-98048631 CTCCAACAGACCTGCAGCAAGGG - Intergenic
1196559909 X:117133437-117133459 CCAAAACAGAAGTACAGCCAAGG + Intergenic
1199969141 X:152845815-152845837 GGAAAACTGAGCTGCAGCAAAGG + Intronic
1200475250 Y:3634176-3634198 TTAAAACAGAGATGAAGAAAAGG + Intergenic
1200548863 Y:4553812-4553834 CTACAACAGACATGCAGCAGAGG - Intergenic
1200718654 Y:6578711-6578733 CTAAAACAAATATGGAGCAATGG - Intergenic
1201362581 Y:13169189-13169211 CTAAAATAGTATTGCAGCAAAGG + Intergenic
1202089008 Y:21169669-21169691 GAAAAACAAGGGTGCAGCAAAGG - Intergenic