ID: 1121605727

View in Genome Browser
Species Human (GRCh38)
Location 14:95238400-95238422
Sequence CTCTGGCGGTATTAAAGTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 59
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 55}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121605712_1121605727 28 Left 1121605712 14:95238349-95238371 CCAGGCCAACGTCCTTCGGTTCC 0: 1
1: 0
2: 0
3: 2
4: 52
Right 1121605727 14:95238400-95238422 CTCTGGCGGTATTAAAGTCAAGG 0: 1
1: 0
2: 0
3: 3
4: 55
1121605713_1121605727 23 Left 1121605713 14:95238354-95238376 CCAACGTCCTTCGGTTCCGACTC 0: 1
1: 0
2: 0
3: 1
4: 24
Right 1121605727 14:95238400-95238422 CTCTGGCGGTATTAAAGTCAAGG 0: 1
1: 0
2: 0
3: 3
4: 55
1121605716_1121605727 16 Left 1121605716 14:95238361-95238383 CCTTCGGTTCCGACTCTTTGGGG 0: 1
1: 0
2: 0
3: 1
4: 40
Right 1121605727 14:95238400-95238422 CTCTGGCGGTATTAAAGTCAAGG 0: 1
1: 0
2: 0
3: 3
4: 55
1121605721_1121605727 -7 Left 1121605721 14:95238384-95238406 CCACTTCCCCCATCGGCTCTGGC 0: 1
1: 0
2: 1
3: 53
4: 935
Right 1121605727 14:95238400-95238422 CTCTGGCGGTATTAAAGTCAAGG 0: 1
1: 0
2: 0
3: 3
4: 55
1121605718_1121605727 7 Left 1121605718 14:95238370-95238392 CCGACTCTTTGGGGCCACTTCCC 0: 1
1: 0
2: 2
3: 12
4: 171
Right 1121605727 14:95238400-95238422 CTCTGGCGGTATTAAAGTCAAGG 0: 1
1: 0
2: 0
3: 3
4: 55

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121605727 Original CRISPR CTCTGGCGGTATTAAAGTCA AGG Intronic
906292360 1:44627611-44627633 CTCTGGGGTTCTTAAAGACAGGG - Intronic
910004898 1:82384295-82384317 CTGTGGCAGTAGTAAAGTCAGGG - Intergenic
911739031 1:101367259-101367281 CTCTGGAAGTATTAGAGTCTGGG + Intergenic
912238257 1:107876245-107876267 TTCTGGCAGTGTGAAAGTCACGG + Intronic
912438611 1:109680681-109680703 CTCTGGGGGTGTTAAATGCAGGG + Intronic
912441132 1:109699126-109699148 CTCTGGGGGTGTTAAATGCAGGG + Intronic
915529991 1:156497868-156497890 CTCTGGGGGTATAAGAGCCAGGG + Intronic
916378595 1:164183448-164183470 CTCCTGGGTTATTAAAGTCATGG + Intergenic
918936096 1:190924393-190924415 CTCTGGGGTTATCAAAGACATGG + Intergenic
919272679 1:195370089-195370111 CTCTGGGGGAAATAAAATCAGGG + Intergenic
1062789237 10:290972-290994 CTCTGGAGTTATAAAAGTGATGG + Intronic
1071993872 10:91127871-91127893 CTCTGGCTGTATTCATGGCATGG + Intergenic
1073789123 10:106921738-106921760 CTCTGTCGGTATTAATGCTAAGG + Intronic
1079195025 11:18318081-18318103 CTCTGGGAGTTTTAGAGTCAGGG - Intronic
1080371769 11:31655668-31655690 ATCATGCGGTATTAAAGTTAGGG + Intronic
1084999644 11:73019716-73019738 CTCTGGGGCTATTACAGTAAAGG + Intronic
1085225122 11:74912969-74912991 CTCTGGGGATATGAAAGGCATGG + Intronic
1088987414 11:114921792-114921814 ATCTGGCTGAATTAAAGCCAGGG - Intergenic
1093271099 12:17063260-17063282 CTCAGTAGGTATTAATGTCAGGG - Intergenic
1101259725 12:103016354-103016376 CTCAGGAGGAATGAAAGTCAAGG + Intergenic
1102448712 12:113024377-113024399 CTCTGGGGGTATGAAACTCAGGG - Intergenic
1102646974 12:114409906-114409928 CTGTTGCAGTATTAAAATCAGGG - Intergenic
1108566516 13:51704220-51704242 CTCTGGAGGTACTAAAGTAGAGG - Intronic
1113443735 13:110349648-110349670 CTCTGGAAGAATAAAAGTCATGG - Intronic
1117272806 14:54162490-54162512 TTCTGGGGGTATTAAAGTTTAGG + Intergenic
1119328702 14:73777852-73777874 CTCTGCAGGTATCAATGTCAAGG - Intronic
1121605727 14:95238400-95238422 CTCTGGCGGTATTAAAGTCAAGG + Intronic
1125885351 15:43225512-43225534 CTCTGGCAGTATTTCAGTCGGGG + Intergenic
1128007670 15:64260075-64260097 CTCAGGAGGAATTAAAGTTAAGG - Intronic
1132401334 15:101507881-101507903 CTCTGACAGTATAAAAGTTAAGG - Intronic
1152006444 17:77684888-77684910 ATCTGGTGGTATGAAAATCAAGG - Intergenic
1152907583 17:82977299-82977321 CTCAAGCCGTTTTAAAGTCACGG - Intronic
932585648 2:73026429-73026451 CAATGCCTGTATTAAAGTCAAGG - Intronic
936460841 2:112712895-112712917 CCCTGGCCGCATTACAGTCACGG - Intergenic
1170298277 20:14853259-14853281 CTCTGGCCTAATTAAGGTCAAGG - Intronic
1170425866 20:16235075-16235097 CTCTGGCAGTATCACAGTGAAGG - Intergenic
1180192700 21:46173694-46173716 CTCTGGAGGTACTATAGGCATGG - Intronic
1182170002 22:28218919-28218941 CACTGACGGTATAAAAGTAATGG - Intronic
951090108 3:18562426-18562448 CTCTGGAGGTCTTAAACTCTTGG - Intergenic
956061372 3:65351443-65351465 CTCTGGAGGGAATAAAGGCATGG - Intergenic
957548080 3:81665871-81665893 TTCTTGAGGTATTAAAATCAGGG - Intronic
977011699 4:91643247-91643269 CTCTGAAGGTTTTAAAGTAATGG + Intergenic
979536196 4:121823461-121823483 CGCTGGCGGTACTGAAGTCCGGG - Exonic
996204546 5:120716221-120716243 CTCTGCTGGTCATAAAGTCAAGG - Intergenic
1000706904 5:164523777-164523799 CTCAGGCTGTAATAAAGTGATGG - Intergenic
1009426375 6:63518231-63518253 CTCTGGCAGCAATAAAGTTATGG - Intergenic
1011906068 6:92369656-92369678 TTCTGGGGGTATTCAAGTCAAGG - Intergenic
1028652095 7:93161450-93161472 CTCTGGAGGTACTCAAGGCAGGG - Intergenic
1030193771 7:106833661-106833683 CTCTGGAAGTATTAAAGTGGCGG - Intergenic
1032732265 7:134655436-134655458 CACTGGAGATATTAGAGTCATGG - Intronic
1032875459 7:136033782-136033804 CTCTGCAGCTATTAAAGGCATGG - Intergenic
1034045070 7:147919212-147919234 GTCTGGCTGTATTAAGATCAAGG - Intronic
1041844269 8:62309606-62309628 CTCTGGAGGTAACAAAGCCAAGG - Intronic
1053279408 9:36808140-36808162 CGCTGGAGGTTTTAAAGTCCAGG - Intergenic
1186714799 X:12240295-12240317 CTCAGGCGGTTTTAAGGGCAAGG + Intronic
1190127874 X:47722339-47722361 CTCTGGGGGTGTTACAGGCAAGG - Intergenic
1190341618 X:49301027-49301049 CTCAGGAAGTACTAAAGTCATGG - Intronic
1190543702 X:51503378-51503400 CTATGACAGAATTAAAGTCAAGG - Intergenic
1199573469 X:149290640-149290662 CTCTGGCTCTATTAGAGCCATGG - Intergenic