ID: 1121605751

View in Genome Browser
Species Human (GRCh38)
Location 14:95238589-95238611
Sequence TGGCAGGCCAAGTCTTGTAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 86
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 81}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121605745_1121605751 24 Left 1121605745 14:95238542-95238564 CCTCTTTGGGACCATGCGCCAAG 0: 1
1: 0
2: 0
3: 5
4: 68
Right 1121605751 14:95238589-95238611 TGGCAGGCCAAGTCTTGTAGAGG 0: 1
1: 0
2: 1
3: 3
4: 81
1121605744_1121605751 25 Left 1121605744 14:95238541-95238563 CCCTCTTTGGGACCATGCGCCAA 0: 1
1: 0
2: 0
3: 2
4: 50
Right 1121605751 14:95238589-95238611 TGGCAGGCCAAGTCTTGTAGAGG 0: 1
1: 0
2: 1
3: 3
4: 81
1121605746_1121605751 13 Left 1121605746 14:95238553-95238575 CCATGCGCCAAGCAGCATGCAAC 0: 1
1: 0
2: 0
3: 4
4: 119
Right 1121605751 14:95238589-95238611 TGGCAGGCCAAGTCTTGTAGAGG 0: 1
1: 0
2: 1
3: 3
4: 81
1121605747_1121605751 6 Left 1121605747 14:95238560-95238582 CCAAGCAGCATGCAACTACTACA 0: 1
1: 0
2: 0
3: 15
4: 113
Right 1121605751 14:95238589-95238611 TGGCAGGCCAAGTCTTGTAGAGG 0: 1
1: 0
2: 1
3: 3
4: 81

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121605751 Original CRISPR TGGCAGGCCAAGTCTTGTAG AGG Intronic
903837803 1:26217126-26217148 TGGAAGGCCCAGTCATGTTGAGG + Intergenic
906040465 1:42784865-42784887 GGGGAGCCCAGGTCTTGTAGTGG - Intronic
918215491 1:182389904-182389926 TGGCCGGCTGAGTCTTCTAGAGG - Intronic
1065772696 10:29092414-29092436 TGGAAGGCCATCTATTGTAGTGG - Intergenic
1068102556 10:52573817-52573839 GAGCAAACCAAGTCTTGTAGAGG - Intergenic
1069894602 10:71672661-71672683 GGGGAGGCCAAGCCTTGCAGGGG + Intronic
1070989339 10:80717892-80717914 TTGCAGGCCCAGACCTGTAGGGG + Intergenic
1071230952 10:83584788-83584810 TGGCAGGACATATCCTGTAGTGG + Intergenic
1073351366 10:102822410-102822432 TGGCAGGCCAGGGGCTGTAGTGG + Intergenic
1080136925 11:28865840-28865862 TGGCATTCCATGGCTTGTAGTGG - Intergenic
1084622531 11:70282773-70282795 TGGGAGGCCAAGGCATGCAGTGG - Intronic
1085108081 11:73863000-73863022 TGGCAGGAGAAATCCTGTAGAGG + Intronic
1088760620 11:112925774-112925796 TGGCAGCCCAAGGCTTGGACAGG + Intergenic
1089196576 11:116696938-116696960 TGGAAGGTCAAGTCCTGGAGGGG - Intergenic
1089320532 11:117623716-117623738 GGCCAGGCTAAGTCTTTTAGAGG - Intronic
1096078548 12:48819073-48819095 TGGCAGGGCAGGGTTTGTAGGGG + Intronic
1097578292 12:61421694-61421716 TGGAAGGCCAAGGCATGTATTGG - Intergenic
1105771310 13:23614775-23614797 TGGCAGGCCCTGTAGTGTAGTGG + Intronic
1106533721 13:30618912-30618934 TGACAGGCTCAGACTTGTAGAGG + Intronic
1108301099 13:49076926-49076948 TGGAAGGCCAAGAATTGAAGGGG - Intronic
1108644576 13:52414287-52414309 TGACTGCCCAAGTCTTTTAGGGG - Exonic
1110896761 13:80762534-80762556 TGGTTGGCAAAGTTTTGTAGTGG - Intergenic
1112202022 13:97286023-97286045 TGGCAGGCCAAGTGTTCTGGTGG - Intronic
1118775281 14:68970073-68970095 GGCCAGGCCAGGGCTTGTAGGGG - Intronic
1120254891 14:82106162-82106184 TGCCAGGCCATGTAGTGTAGAGG - Intergenic
1121605751 14:95238589-95238611 TGGCAGGCCAAGTCTTGTAGAGG + Intronic
1127221285 15:56884169-56884191 TGGAAGGCCAGGTCTTGAAATGG + Intronic
1128214025 15:65922201-65922223 AGGCAGCCCAAGTCCTGAAGAGG + Intronic
1129275240 15:74441177-74441199 TGGCAGCTCAGGTCTTGGAGGGG - Intergenic
1129362035 15:75030056-75030078 TGGCAGGCCATGTCTGGAACAGG + Intronic
1129996787 15:80013731-80013753 TGGGAGGCCAAGGCTGGTGGAGG - Intergenic
1134790318 16:16983733-16983755 TGGCAGGCCAAGCCTTCATGGGG + Intergenic
1141027873 16:80564958-80564980 TGGCAATCCCAGGCTTGTAGCGG + Intergenic
1147019569 17:37520765-37520787 TGGGAGGTTAATTCTTGTAGTGG - Intronic
1148070989 17:44908380-44908402 TGCCAGGCCAGGGCTTGCAGAGG - Intronic
1152607817 17:81301875-81301897 AAGCAGGCCAGGGCTTGTAGGGG - Intergenic
1165758135 19:38305752-38305774 TGCCAGGCAAGGTCTTGGAGCGG + Intronic
926741607 2:16115946-16115968 GGGCCAGCCAAGTCTTGGAGGGG + Intergenic
926822839 2:16872123-16872145 AGGTGGGCCCAGTCTTGTAGGGG + Intergenic
937352484 2:121175050-121175072 TGGCAGGCCCAGTCTGGCGGTGG - Intergenic
938743836 2:134258741-134258763 TGGCAGGTCGAGAGTTGTAGTGG + Intronic
938753653 2:134359996-134360018 TGGGAGGCGAAGGCATGTAGAGG + Intronic
939177916 2:138771646-138771668 TCTCAGGCAAAGTCTTGCAGAGG + Intronic
941252898 2:163188467-163188489 TAGCAGGCCCAGTCATGTAGAGG + Intergenic
942555686 2:177170366-177170388 TGGCAGGGCAGGCCTTGCAGAGG + Intergenic
944328174 2:198432215-198432237 TTGCAGCTCAAGTTTTGTAGAGG + Intronic
1180201681 21:46228556-46228578 TGGCGGGCTCGGTCTTGTAGGGG + Exonic
949864035 3:8532652-8532674 CAGCACGCCAAGTCTTTTAGAGG + Intronic
953134986 3:40174648-40174670 TGGCAGAACAAGTCTATTAGTGG + Intronic
954755378 3:52836327-52836349 GGGCAGGCCAGGCCTTGTGGGGG + Intronic
959523271 3:107345008-107345030 TGTCAGGCCAAGTCTGGTAGTGG - Intergenic
962531617 3:136286504-136286526 TGGCAGGTCTAGTCTTCCAGTGG + Intronic
963482867 3:145899002-145899024 TGGCAGGCAATGCCTGGTAGAGG - Intergenic
963642423 3:147876882-147876904 TGGCTGGACCAGGCTTGTAGTGG + Intergenic
964372589 3:156016523-156016545 TCTCAGGCCTAGTCTTGGAGTGG + Intergenic
966888486 3:184389621-184389643 TGGCAGGGCAGGACTTGGAGTGG - Exonic
967553124 3:190823129-190823151 TGGCAGGTCTAGCATTGTAGCGG + Intergenic
967937695 3:194742055-194742077 AGGCTGGCCAAGGCTTGGAGGGG + Intergenic
969082691 4:4631953-4631975 TGGCAGGCCAGGCCTGGAAGTGG - Intergenic
971267097 4:25105479-25105501 AGGGAGGCCAGGTCTGGTAGAGG - Intergenic
974666765 4:64971909-64971931 TGCCAGACCAAGTTTTGTAATGG - Intergenic
978967131 4:114754076-114754098 TGGGAGATCAAGTCTTGTAAAGG + Intergenic
988675462 5:33428450-33428472 TCACAGCCCAAGGCTTGTAGAGG + Intergenic
991438348 5:66619013-66619035 TGTCACCCCAAGTCTTGTGGAGG + Intronic
993548503 5:89243947-89243969 TGGCAGGCCATGACTTTCAGAGG + Intergenic
995840925 5:116442435-116442457 TGGCAGGGCAAGTCTGGGAAAGG - Intergenic
998865876 5:146501760-146501782 TGAAAGGCCAAGTTTAGTAGTGG + Intronic
999364723 5:151014772-151014794 TGCCAGGCCAGGTCCTGTTGAGG + Intergenic
1001884447 5:175276514-175276536 TGCCATGCCACTTCTTGTAGTGG - Intergenic
1004437899 6:15614583-15614605 TGGCATCCCAAGTCCTGCAGTGG - Intronic
1007317099 6:40997889-40997911 TGTCTGGCCAAGTCCTGTGGGGG - Intergenic
1019686414 7:2384443-2384465 AGGGAGGCCATGTCTTGTTGGGG + Intergenic
1024657288 7:51461790-51461812 TGGGAGACCACGTTTTGTAGTGG + Intergenic
1028120934 7:87056121-87056143 TGTCATGCCAAGTCTTGGATGGG + Intronic
1032341402 7:131076789-131076811 AGCCAGGTCCAGTCTTGTAGTGG - Intergenic
1034462004 7:151203214-151203236 TGGGAGGCCAAGTCTTGTCTTGG + Intronic
1037488266 8:19371243-19371265 TTATAGGCCAAGTCTGGTAGTGG + Intronic
1043330330 8:79109479-79109501 TGTGAGGCCAAGTCTTTTACAGG + Intergenic
1047244104 8:123123246-123123268 TGGCAGGCCACGTCTGCTAAAGG + Intronic
1050386804 9:5099592-5099614 TGGTAGGCCTAGAATTGTAGGGG - Intronic
1050862037 9:10447106-10447128 TGGCAGGGCGATTCCTGTAGTGG + Intronic
1055048623 9:71957052-71957074 TGGGAGGCCAAGGCTGGCAGAGG - Intronic
1062586015 9:137250450-137250472 TGGCAGGCCCAGTGCTGAAGGGG + Intergenic
1186541562 X:10406331-10406353 TGCCTGGCTAAGTTTTGTAGAGG + Intergenic
1194962088 X:100247452-100247474 TGGGAGGCCAAGGCGTGTGGTGG + Intergenic
1197428079 X:126323288-126323310 TGGCAAGCCAGGTGTTGTGGGGG - Intergenic