ID: 1121607662

View in Genome Browser
Species Human (GRCh38)
Location 14:95253146-95253168
Sequence GTCAGGGGCCACAGTGGGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 610
Summary {0: 1, 1: 0, 2: 3, 3: 50, 4: 556}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121607662_1121607674 9 Left 1121607662 14:95253146-95253168 CCATGCCCACTGTGGCCCCTGAC 0: 1
1: 0
2: 3
3: 50
4: 556
Right 1121607674 14:95253178-95253200 TGGAAAGGACAAAGGAACTGAGG 0: 1
1: 0
2: 5
3: 48
4: 783
1121607662_1121607669 -6 Left 1121607662 14:95253146-95253168 CCATGCCCACTGTGGCCCCTGAC 0: 1
1: 0
2: 3
3: 50
4: 556
Right 1121607669 14:95253163-95253185 CCTGACCACCCACATTGGAAAGG 0: 1
1: 0
2: 2
3: 16
4: 148
1121607662_1121607671 1 Left 1121607662 14:95253146-95253168 CCATGCCCACTGTGGCCCCTGAC 0: 1
1: 0
2: 3
3: 50
4: 556
Right 1121607671 14:95253170-95253192 ACCCACATTGGAAAGGACAAAGG 0: 1
1: 0
2: 0
3: 21
4: 223
1121607662_1121607675 13 Left 1121607662 14:95253146-95253168 CCATGCCCACTGTGGCCCCTGAC 0: 1
1: 0
2: 3
3: 50
4: 556
Right 1121607675 14:95253182-95253204 AAGGACAAAGGAACTGAGGAAGG 0: 1
1: 0
2: 8
3: 103
4: 1105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121607662 Original CRISPR GTCAGGGGCCACAGTGGGCA TGG (reversed) Intronic
900108557 1:996427-996449 GTCTGGGGCCACAGGATGCAGGG + Intergenic
900108606 1:996559-996581 GTCTGGGGCCACAGGATGCAGGG + Intergenic
900108656 1:996691-996713 GTCTGGGGCCACAGGATGCAGGG + Intergenic
900108705 1:996822-996844 GTCTGGGGCCACAGGATGCAGGG + Intergenic
900280368 1:1863423-1863445 GGCAGCAGCCACAGTGGGCAAGG - Intronic
900680921 1:3915750-3915772 GCCAGGGGCCACAGTGTCCCAGG - Intergenic
900988116 1:6085130-6085152 GCCAGTGGCCACAGTGGGTCTGG + Intronic
901225862 1:7612658-7612680 GGCAGGGGTCACAGTGTGCATGG + Intronic
901557979 1:10046639-10046661 GTCAGAGGCTACAGAGGGCCAGG - Intronic
901866775 1:12111657-12111679 CTCAGGAGGAACAGTGGGCAGGG + Intronic
902189945 1:14755329-14755351 GTCAGGGGCAGCAAAGGGCAGGG - Intronic
902559239 1:17266728-17266750 GTCTGGGGGCCCAGTGGGTATGG + Exonic
903133170 1:21292261-21292283 ATGAGGGCCCAGAGTGGGCAGGG - Intronic
903320569 1:22540718-22540740 GTCAGGGCCCAGAGTATGCAGGG + Intergenic
903322561 1:22551777-22551799 GGCTGGAGCCACAGTGGTCACGG + Intergenic
903657753 1:24959447-24959469 GGCAAGCGCCATAGTGGGCACGG + Intronic
903891497 1:26573203-26573225 TCCTGGGGACACAGTGGGCAAGG - Exonic
904842118 1:33379394-33379416 GGCAAGGGGGACAGTGGGCAGGG - Intronic
905620535 1:39441995-39442017 GTCAGTGCCAACAGGGGGCATGG - Exonic
906059041 1:42936494-42936516 CCCAGGGGACCCAGTGGGCAGGG - Intronic
906963620 1:50435141-50435163 GGCAGAGGACACAGTGTGCAAGG + Intergenic
907050926 1:51329723-51329745 TTCCTGGGCCCCAGTGGGCAGGG - Intronic
907565700 1:55431244-55431266 GTCAGGAGGCACAGGGGTCAGGG - Intergenic
908513990 1:64873646-64873668 GTGAGGGGCTACAAGGGGCAGGG - Intronic
908724022 1:67156253-67156275 GTCAGGAGGCACAGGGGTCAGGG + Intronic
909415732 1:75403376-75403398 GTCAGGAGGCACAGGGGTCAGGG - Intronic
909493062 1:76247262-76247284 GTCAGGAGACACAGGGGTCAGGG + Intronic
910177269 1:84443750-84443772 GTCAGGAGGCACAGGGGCCAGGG - Intergenic
911335268 1:96573904-96573926 TTTAGTGGCCACAGTGGGGAAGG - Intergenic
912007040 1:104917006-104917028 GTCAGGAGGCACAGGGGTCAGGG + Intergenic
912133295 1:106628199-106628221 GTCAGGAGGCACGGGGGGCAGGG + Intergenic
912301865 1:108526107-108526129 GGCAGGTGCCTCAGAGGGCAGGG + Intergenic
912738840 1:112174846-112174868 GTCAGGGGCCCCAGTAGGGCAGG - Intergenic
913036721 1:114973543-114973565 GTGAGGAGCCACAGTGAGTAGGG + Intronic
913108597 1:115638932-115638954 GTCAGGAGGCACAGGGGTCAGGG + Intergenic
915061304 1:153188165-153188187 GTCAGGAGGCACAGGGGTCAGGG + Intergenic
916081098 1:161232893-161232915 CACAGGGGCCAGGGTGGGCAAGG + Exonic
916144352 1:161726352-161726374 GGCAGGGGCCACTGTGGGACTGG + Intronic
916406341 1:164501158-164501180 GTCAGGAGGCACAGGGGTCAGGG - Intergenic
917158009 1:172025482-172025504 GTCAGGAGGCACGGTGGTCAGGG - Intronic
917274698 1:173319536-173319558 GTCAGGAGGCACAGGGGTCAGGG - Intergenic
918407136 1:184222515-184222537 GTAAGGGGCCAGAGTGGGCATGG - Intergenic
919730852 1:200912843-200912865 ATCTGGGGCCACAGAGGCCAGGG + Intronic
919845644 1:201640487-201640509 GACAGGGGGAAAAGTGGGCAAGG - Intronic
921219535 1:212963328-212963350 TGCAGTGGCCCCAGTGGGCAGGG - Intronic
921296787 1:213711974-213711996 GTCAGGAGGCACAGGGGTCAGGG + Intergenic
922776932 1:228219125-228219147 GCCAGGGCCCTCACTGGGCAGGG + Intronic
924493932 1:244568303-244568325 GTCAGGAGACACAGGGGTCAGGG + Intronic
924624011 1:245685487-245685509 GTCAGGGTCCACCGTGGCCCTGG - Exonic
924823047 1:247512971-247512993 GTCAGGAGGCACAGGGGTCAAGG + Intronic
1062937785 10:1400992-1401014 GTCAGGGGCCCCAGCGGTTAAGG - Intronic
1068401534 10:56534125-56534147 GTCAGGGGGCAGAAGGGGCAGGG - Intergenic
1069139865 10:64809894-64809916 GTCAGGAGGCACAGAGGTCAGGG + Intergenic
1070777086 10:79116098-79116120 GTAAGGGGCTACAGAGTGCAGGG - Intronic
1072268298 10:93751495-93751517 GTCAGGGGCCCGAGGGAGCAAGG - Intergenic
1072493635 10:95933841-95933863 GTCAGGAGGCACAGGGGTCAGGG + Intronic
1074777036 10:116774389-116774411 GTCAGGGACCACACTGGTCAGGG - Intergenic
1074975803 10:118580749-118580771 GTCAGCATCCACAGAGGGCATGG + Intergenic
1075119330 10:119652224-119652246 AGCAGGGGCCACGGTGGGCCGGG - Intronic
1075705383 10:124497313-124497335 GGCAGGGTCCACGGCGGGCAGGG - Intronic
1075712601 10:124538551-124538573 GTATGGGGCCACAGCGGGCAGGG - Intronic
1075903941 10:126064623-126064645 GTCTGAGGCCGCACTGGGCATGG - Intronic
1076207560 10:128615267-128615289 GTGAGGGGCCTGGGTGGGCAGGG + Intergenic
1076389867 10:130091099-130091121 GTCAGGAGGCACAGGGGCCAGGG - Intergenic
1076613691 10:131742864-131742886 GTCTGGGGCCCCTGTGGGCCTGG + Intergenic
1076775020 10:132690545-132690567 GTGAGTGGCCACTGTGGGCTGGG + Intronic
1077094003 11:791783-791805 GGCAGGGGCAGCAGGGGGCAGGG - Exonic
1077111226 11:863106-863128 GGAAGGGGCCACAGTGGGGGTGG - Intronic
1077162252 11:1119180-1119202 GTCAGGAGCCACAGTGACCTGGG - Intergenic
1077561981 11:3269872-3269894 GTCAGGAGGCACAGGGGTCAGGG + Intergenic
1077567876 11:3315692-3315714 GTCAGGAGGCACAGGGGTCAGGG + Intergenic
1077629934 11:3804554-3804576 GAAAGGGGACACAGTGAGCATGG - Intronic
1078331426 11:10425548-10425570 GTCAGGAGGCACAGGGGTCAGGG + Intronic
1078489490 11:11756090-11756112 GCCAGGGCCCACCATGGGCAGGG - Intergenic
1078746997 11:14125319-14125341 GTCACTGGCCACATTGTGCATGG + Intronic
1081202610 11:40236053-40236075 GTCACGGCTCACAGTGGGCATGG + Intronic
1081989188 11:47328540-47328562 GTGAGAGGCCACAGAGGGGAAGG + Intronic
1082011475 11:47452702-47452724 TTGAGGGGCCACAGTGTGCCGGG - Intergenic
1083260426 11:61519521-61519543 GTCAAGGGCCAGAGGGGACAGGG + Intronic
1083353488 11:62047883-62047905 GCTGGGGGCCAAAGTGGGCAAGG - Intergenic
1083442888 11:62688474-62688496 GCCAGGAGCCACAGAAGGCAGGG + Exonic
1083607662 11:63988399-63988421 GTGAGGGGCTGCAGTGGGCGAGG + Intronic
1083887231 11:65578903-65578925 ATCTGGGGCCACAGGGTGCAGGG - Intronic
1083994526 11:66265574-66265596 CTCAGGGCCCACTGTGGGCTGGG + Intronic
1084084547 11:66849036-66849058 GGCAGGGGCCAAGGTGGCCAAGG - Exonic
1084213406 11:67634162-67634184 GGCCGGGGCCACGGTGGGGACGG - Intronic
1085038244 11:73312258-73312280 CTCAGGGGCCACAGTTGACATGG + Intronic
1085302646 11:75467488-75467510 CTCAGGGCCACCAGTGGGCAGGG + Intronic
1085498233 11:76992545-76992567 GACACAAGCCACAGTGGGCATGG - Intronic
1086385170 11:86299726-86299748 ATCAGGGGCCACAGAATGCAAGG - Intergenic
1087368222 11:97248572-97248594 GACTGGGACCACAGAGGGCAGGG + Intergenic
1087667853 11:101071002-101071024 GTCAGGAGGCACAGGGGTCAGGG - Intronic
1087868321 11:103261376-103261398 GTCAGGAGGCACAGGGGTCAGGG - Intronic
1088078247 11:105878375-105878397 GTCAGGAGGCACAGGGGTCAGGG + Intronic
1090459359 11:126876470-126876492 ATCAGGTGCAACAGTGAGCAGGG - Intronic
1091384590 12:84923-84945 GTCAGGGGGTACAGTGAGAATGG + Intronic
1092213934 12:6667384-6667406 GTAAGTGGCCACACTGGACAAGG + Exonic
1093022144 12:14213704-14213726 ATCAGGGGACCCAGGGGGCATGG + Intergenic
1093335982 12:17905531-17905553 GTCAGGAGGCACAGGGGTCAGGG + Intergenic
1093664405 12:21795010-21795032 GTCAGGAGGCACAGGGGTCAGGG + Intergenic
1094155873 12:27336336-27336358 GGCAGGGGCTACAGAGGGCTGGG - Intronic
1094431033 12:30369261-30369283 GACAGGGGACATAGTGGGAATGG + Intergenic
1097635135 12:62113445-62113467 GTCAGGAGGCACAGGAGGCACGG + Intronic
1098906592 12:76169331-76169353 GTCAGGAGGCACAGGGGTCAGGG + Intergenic
1099113159 12:78587345-78587367 AGCAGGGGCAGCAGTGGGCAGGG + Intergenic
1099253655 12:80289356-80289378 GTCAGGAGGCACAGGGGTCAGGG + Intronic
1099744914 12:86689774-86689796 GTCAGGAGGCACAGGGGTCAGGG + Intronic
1099851156 12:88098933-88098955 ATCAGGGGCCACACCAGGCAGGG + Intronic
1100111113 12:91243232-91243254 GTCAGGAGGCACAGGGGTCAGGG - Intergenic
1100798061 12:98202655-98202677 GTAAGGGGGCACAGGGGTCAGGG - Intergenic
1102647548 12:114413760-114413782 TTCTGGGGCCTCAGTGGGAATGG - Intergenic
1103058011 12:117836698-117836720 GACACGGGCCACAGTTGGCAAGG - Intronic
1103146488 12:118599544-118599566 GGCAGAGGCCAGAGTGTGCAGGG - Intergenic
1103329699 12:120145385-120145407 GTCAGGGTCCACAGTGGAACAGG - Intronic
1103727598 12:123005800-123005822 GTCAGAAGCCACAGTTGGAAGGG + Intronic
1104541471 12:129669975-129669997 GACAGGGGACATAGTGGGAATGG - Intronic
1104858290 12:131912090-131912112 GTCAGGGGGCACGCTGGGCTTGG + Intronic
1105608352 13:21945823-21945845 GTGAGGGGCCACAGTGAGCCAGG + Intergenic
1105737319 13:23285069-23285091 GTCAGGAGGCACAGGGGTCAGGG + Intronic
1105774503 13:23645090-23645112 GGAAGGGGCTACAATGGGCAGGG + Intronic
1106336523 13:28788648-28788670 GTCAGGAGGCACAGGGGTCAGGG + Intergenic
1106421817 13:29591673-29591695 TTCTGGGGGCACAGAGGGCATGG - Intronic
1106426525 13:29636118-29636140 GTCAGGAGGCACAGGGGTCAGGG + Intergenic
1107674025 13:42776411-42776433 GTCAGGAGGCACAGGGGTCAGGG + Intergenic
1108048750 13:46408552-46408574 GTCAGGAGGCACAGGGGTCAGGG + Intronic
1108093534 13:46876826-46876848 GTAAGGGTCCACAGTGGATAAGG - Intronic
1108235111 13:48394926-48394948 GTCAGGAGGCACAGGGGTCAGGG - Intronic
1108441327 13:50456267-50456289 GCCAAGAGCCACAGTGGACAAGG - Intronic
1108599927 13:51983592-51983614 GTCAGGAGACACAGGGGTCACGG - Intronic
1109187968 13:59292379-59292401 GTCAGGAGCCACGGGGGTCAGGG - Intergenic
1109510237 13:63362504-63362526 GTCTGGGGCCAGGCTGGGCATGG - Intergenic
1109541283 13:63781897-63781919 GTCAGGAGGCACAGGGGTCAGGG + Intergenic
1109661560 13:65467061-65467083 GTCAGGAGGCACAGGGGTCAGGG + Intergenic
1112151987 13:96773857-96773879 GTCAGGAGACACAGGGGTCAGGG - Intronic
1112231670 13:97593899-97593921 GTCAGGAGGCACAGGGGTCAGGG - Intergenic
1113949223 13:114061958-114061980 CTCAGGGGACATGGTGGGCAGGG + Intronic
1115162283 14:30409909-30409931 GTCAGGAGGCACAGGGGTCAGGG + Intergenic
1115265436 14:31495079-31495101 GTCAGGAGGCACAGGAGGCAGGG - Intronic
1115275745 14:31606671-31606693 CTCATGGGCCACAGAGGGCAGGG + Intronic
1115974341 14:38980652-38980674 GTCAGGAGCCACAGGGGTCAGGG + Intergenic
1116958186 14:50944634-50944656 CTCTGGGGCCGCAGTGGGCTCGG + Exonic
1117121132 14:52568974-52568996 GTCAGGAGGCAAAGTGGTCAGGG - Intronic
1119133731 14:72197516-72197538 GCCTGGGGCTACAGTGGGTAGGG + Intronic
1120338515 14:83189749-83189771 GTCAGGAGCCACAGGAGTCATGG + Intergenic
1121096183 14:91219669-91219691 GCCAAGGGCCAGAGTGGGCAGGG - Intronic
1121312191 14:92941185-92941207 GTCCCGGTCCACAGTGGCCATGG + Exonic
1121607662 14:95253146-95253168 GTCAGGGGCCACAGTGGGCATGG - Intronic
1121648833 14:95540525-95540547 GGCACGGGGCAGAGTGGGCAAGG - Intronic
1122005295 14:98698512-98698534 GCCAGCGGCCACACTGGGAATGG - Intergenic
1122266316 14:100548571-100548593 GTGAGGGGGCACAGTGAGCTAGG - Intronic
1122570574 14:102696601-102696623 GTGAGGAGCCACTGAGGGCAGGG - Intronic
1122789799 14:104179414-104179436 GTCAGGGCACACGGTGGGCCGGG - Intronic
1122794025 14:104196774-104196796 GTCAGGGGCACCTGTGGGCACGG - Intergenic
1122838546 14:104443289-104443311 CTCAGGGTCCAGAGTGGGGAGGG - Intergenic
1123091306 14:105743531-105743553 GTCAGGGGCTTCAGGGGGCTCGG - Intergenic
1124138919 15:27060309-27060331 CTCAGGGGCCAGTGTGGCCAAGG - Intronic
1124406228 15:29394736-29394758 GTCAGGGGCTAGAGTGGGGGAGG - Intronic
1124553859 15:30708157-30708179 CTCAGGGGCCACAGAAGACAAGG - Intronic
1124677390 15:31697514-31697536 CTCAGGGGCCACAGAAGACAAGG + Intronic
1125343167 15:38694372-38694394 GACAGAGGCAACAGTGGGTAAGG + Intergenic
1127849130 15:62897806-62897828 GGCAGGGGCCACACTGGGTGGGG - Intergenic
1127966206 15:63924657-63924679 GCCAGGGGCCCCAGAGGGCCTGG - Intronic
1128737738 15:70062811-70062833 GGCAGAGGCAGCAGTGGGCAGGG - Intronic
1128902083 15:71433565-71433587 CTCAGGGGACACACTGGGGAGGG - Intronic
1129098326 15:73233233-73233255 CACTGGGGCCACAGTGGGCATGG + Intronic
1129390117 15:75216134-75216156 GTCAGGGGCCTTGGTGGACAGGG - Intergenic
1130651301 15:85763608-85763630 TGCAGAGGCCACAGTGTGCAGGG + Intronic
1130693303 15:86104874-86104896 TTCAGGGCCCACAATGGTCAAGG + Intergenic
1130715571 15:86330110-86330132 GGCAGCAGCCACAGTGGGCAGGG - Intronic
1131067813 15:89445084-89445106 GTCTGGCGCCACCGTGAGCAGGG - Intergenic
1131576685 15:93599222-93599244 GTCAAAGGCCACAGTAGCCATGG - Intergenic
1132299193 15:100766014-100766036 GTCTGGGGCAACACGGGGCAAGG + Intergenic
1133301117 16:4783589-4783611 GGCAGAGGGCAGAGTGGGCAGGG - Intronic
1133935767 16:10267970-10267992 GGCAGAGGTTACAGTGGGCAAGG + Intergenic
1134416586 16:14048558-14048580 CACAGGGGCCAGAGTGTGCAGGG + Intergenic
1134487237 16:14668123-14668145 CTCAGGGTCCTCAGTGGACATGG + Exonic
1134552415 16:15144223-15144245 GGAAGGGGCCACAGTGGGGGTGG - Intergenic
1134826985 16:17292903-17292925 TAAGGGGGCCACAGTGGGCAGGG + Intronic
1135102330 16:19616860-19616882 GTTAAAGGGCACAGTGGGCAGGG - Intronic
1135409258 16:22220831-22220853 GTCAGCGGCCACTGGGGGCCAGG - Intronic
1136343940 16:29663339-29663361 GGTAGGGGCCTCAGTGGGCCTGG + Intronic
1136526469 16:30834527-30834549 CTCCGGGTCCACAGCGGGCAAGG - Exonic
1137969924 16:52975026-52975048 GTCAGGAGGCACAGAGGTCAGGG + Intergenic
1138526049 16:57607863-57607885 CTCAGGGGCCACCGTGTGCTAGG - Intergenic
1138562100 16:57807405-57807427 GCCAGGCTCCTCAGTGGGCATGG + Intronic
1138843588 16:60538733-60538755 GTCAGGAGGCACAGGGGTCAGGG + Intergenic
1139545228 16:67646849-67646871 GCCTGGGGCCACAAGGGGCAGGG - Intronic
1140165307 16:72544181-72544203 GTCAGGAGGCACAGGGGTCAGGG - Intergenic
1140534335 16:75695649-75695671 GTGAGGGGCCACCCTGTGCATGG - Intronic
1141002108 16:80317830-80317852 GGCAGGCGCCAGTGTGGGCAAGG + Intergenic
1141246055 16:82308872-82308894 GTCAGGAGGCACAGGGGTCAGGG + Intergenic
1141998525 16:87649738-87649760 CCCAGGGGCCAAAGTGGGGAGGG - Intronic
1142208000 16:88793095-88793117 GGCAGGGGCAGGAGTGGGCAGGG - Intergenic
1142219700 16:88847984-88848006 GTCATGGTCCACAGTGTGGAGGG - Intronic
1142691311 17:1607494-1607516 ATCAGAGGCCTCAGGGGGCAGGG + Intronic
1143027145 17:3947621-3947643 GCCAGGAGCCACCGTGGGCCGGG + Exonic
1143103126 17:4514889-4514911 GTCAGGGGCCACACAGGGCGGGG - Intronic
1143378493 17:6480938-6480960 GCCAGGGCCCACAGTGGGCAAGG + Intronic
1143498184 17:7324249-7324271 GGCAGGGGACACGGTGGGCGTGG - Exonic
1143516173 17:7420321-7420343 GTCAGTGGACACTGTCGGCACGG + Intergenic
1143632008 17:8144911-8144933 GTCAGGGGCTACTGTGGGGCTGG + Exonic
1143832561 17:9663997-9664019 GTCTGGTGCCACAGTGGGTGGGG - Intronic
1144896087 17:18534552-18534574 CTCAGGGGAAACAGTGGGAAGGG - Intergenic
1145166354 17:20615561-20615583 GTCAGGTGGAACAGTGAGCAGGG + Intergenic
1146953559 17:36922787-36922809 TTCAGGGGCCACACAGGGCTAGG - Intergenic
1147240043 17:39084821-39084843 GGCAGGGGGCGCAGTAGGCACGG + Intronic
1147658429 17:42104250-42104272 GTCGGGGGCAACAGTGGGAGGGG + Intronic
1147666440 17:42151643-42151665 CTCAGGGGTCCCACTGGGCAGGG - Intronic
1148447480 17:47746352-47746374 GTCAGGGTGCACACAGGGCAAGG - Intergenic
1148469817 17:47885888-47885910 GTCAGAGGCCAGAGTGGGAGTGG + Intergenic
1148737816 17:49874634-49874656 GCCAGGGGCCATGGTGGGAAGGG - Intergenic
1148840762 17:50495392-50495414 TTCGGGGGACACAGTGGCCAAGG - Intergenic
1149561561 17:57611321-57611343 GTGTGGGGCTACAGTGGGAAGGG + Intronic
1149736795 17:59002754-59002776 GTCAGGGACCACAGTTGCCCTGG + Intronic
1150190584 17:63233476-63233498 CTCAGGAGCCACACAGGGCAAGG - Intronic
1150216696 17:63475441-63475463 GCCAGGGGCCAGGGAGGGCAAGG - Intergenic
1150445221 17:65223432-65223454 GCCAGGGGCCACTGAGGGCAGGG - Intronic
1150540185 17:66088826-66088848 GCCAGGGGCCTGAGTGTGCAGGG - Intronic
1150737550 17:67753296-67753318 GTCGGTGGCCACAGTGGAAATGG - Intergenic
1151575338 17:74950255-74950277 GCCAGGGGCCACAGCCTGCATGG - Intergenic
1152039187 17:77892211-77892233 CTCAGGGGCCACAGTGGCAGAGG - Intergenic
1152076714 17:78164504-78164526 GGCAGGGGCCAGGGTGGGCATGG - Intronic
1152130154 17:78471739-78471761 CCCAGCGGTCACAGTGGGCAGGG - Intronic
1152301175 17:79495859-79495881 GGCAGAGGCCCCTGTGGGCAGGG + Intronic
1152333426 17:79686384-79686406 GTGAGAGACCACAGTGGTCAGGG + Intergenic
1152427660 17:80226971-80226993 TTCAGAGGCACCAGTGGGCAGGG + Intronic
1154101488 18:11478908-11478930 GTCAGGAGGCACAGGGGTCAGGG + Intergenic
1154107099 18:11533049-11533071 GTCAGGGGCCACACTGCCCGCGG + Intergenic
1155338679 18:24792177-24792199 GTCGGGGGACACAGTGAGGATGG - Intergenic
1156260422 18:35440696-35440718 CCCAGGGGCCCCAGTAGGCATGG - Intergenic
1156421670 18:36960513-36960535 GTCAGGCTACACAGTGGTCAGGG - Intronic
1157068153 18:44375521-44375543 GTCAGGGGGCACAGGGACCAGGG - Intergenic
1157287852 18:46389554-46389576 GTCAGGGGCAACCGTGGGGGTGG + Intronic
1158398973 18:57103917-57103939 GTCAGGAGGCACAGGGGTCAGGG + Intergenic
1158677061 18:59529611-59529633 CTCAGGAGCCACACAGGGCAAGG - Intronic
1160846593 19:1168750-1168772 GTCCGGGGCCATGGCGGGCAGGG + Intronic
1160983819 19:1828366-1828388 GTCCGGGCCCACAGTGGGGCTGG + Exonic
1161118377 19:2511958-2511980 GTGAAGGGCCACAGCGGGCCAGG - Exonic
1161137231 19:2626900-2626922 GTCAGTGTCCACAGTGCCCAGGG + Intronic
1161270054 19:3384844-3384866 AGCAGGGGCCACCGTGGGGACGG + Intronic
1161486698 19:4539728-4539750 GCCTGGGGCCACAGTGACCAAGG - Intronic
1161793851 19:6375550-6375572 GTCAGGCTCCACAGCTGGCATGG + Exonic
1162626293 19:11887774-11887796 GTCTGGAGGAACAGTGGGCAGGG - Intronic
1163379063 19:16952251-16952273 CTCAGGGGGGCCAGTGGGCATGG + Intronic
1163429150 19:17256567-17256589 TGCACGGGGCACAGTGGGCATGG + Exonic
1163835978 19:19574406-19574428 GCCAAGGGCCACAGTGGCCACGG - Intronic
1164047471 19:21555103-21555125 GTCAGGAGGCACAGGGGTCAGGG + Intronic
1164459841 19:28437415-28437437 GTCAGAGGGGACAGTGAGCAGGG - Intergenic
1164575016 19:29400845-29400867 AGAAAGGGCCACAGTGGGCATGG + Intergenic
1164839445 19:31381288-31381310 TTCAGAGGACACAGAGGGCATGG - Intergenic
1164885762 19:31777213-31777235 GCCAGGTGACTCAGTGGGCATGG + Intergenic
1165166997 19:33863733-33863755 GCCAGTGGACACAGTGGGCATGG + Intergenic
1165823575 19:38692831-38692853 GTCAGAGGCCACAGCAGGCAAGG + Intronic
1165856831 19:38883970-38883992 GGCAGGGGCCAGGCTGGGCATGG + Intronic
1165865205 19:38932702-38932724 GGCTGGGGGCACAGTGGGCTGGG + Exonic
1165970330 19:39623781-39623803 GTCAGGAGGCACAGGGGTCAGGG + Intergenic
1165992348 19:39823858-39823880 GGCAGGGGCCACCGTAGGGAGGG - Intergenic
1166123556 19:40700280-40700302 GTCTGGTGGCACAGTGGGAAGGG - Intronic
1166320628 19:42016482-42016504 CTCAGGGGCCAGAGGGTGCATGG - Intronic
1166338375 19:42122466-42122488 GGCAGGGGTCACCGTGGGCAGGG - Intronic
1166419845 19:42628108-42628130 GACAGGGGACATAGTGGGAATGG - Intronic
1166843658 19:45713298-45713320 GGCAGGGACCTCAGTGGCCAAGG + Exonic
1167610705 19:50506564-50506586 GACAGGGGCCTGTGTGGGCAGGG + Exonic
1168316202 19:55485787-55485809 GGCAGGGGCCCCAGGGGGCCTGG + Intronic
925245249 2:2376891-2376913 GTCAGGAGACACAGGGGTCAGGG + Intergenic
925954926 2:8954399-8954421 GGCAGGGGCCACAAAGAGCAGGG + Intronic
926533606 2:14082763-14082785 GTCAGGAGGCACAGGGGTCATGG - Intergenic
927038645 2:19206028-19206050 GTCTGATGCCACAGTGGCCAGGG - Intergenic
927488362 2:23504558-23504580 GGGAGGGGGCACAGGGGGCAGGG + Intronic
927661889 2:25000506-25000528 TGCAGAGGCCACAGTGGGGAGGG + Intergenic
928374000 2:30760420-30760442 CTCAGGGGCTCCAGTGGGCATGG + Intronic
928438681 2:31273306-31273328 GGCAGTGGCCACAGTAGGCTAGG - Intergenic
928830612 2:35478267-35478289 GTCAGGAGGCACAGCGGTCAGGG - Intergenic
929062844 2:37941354-37941376 GTCAGGAGGCACAGGGGTCAGGG + Intronic
929547055 2:42862703-42862725 TTGAGGGGCCACTGAGGGCAGGG + Intergenic
932418097 2:71585937-71585959 GTCAGGGGACACATGGGGCAAGG + Intronic
932709119 2:74048882-74048904 GTCAGGGGCCAGATTGTGTAGGG + Intronic
932913947 2:75834670-75834692 GTCAGGAGGCACAGGGGTCAGGG - Intergenic
933290394 2:80431962-80431984 GTGAGTGGCCACAGTGCCCAGGG + Intronic
933767570 2:85720503-85720525 GGCAGGGGCTAGATTGGGCAGGG + Intergenic
934112696 2:88757390-88757412 GACAGGGGCCGGAGTGGCCAGGG + Intergenic
934548181 2:95236039-95236061 GGCAGGGGACTCTGTGGGCAAGG + Intronic
935094629 2:99932607-99932629 GTAAGGGGCCATAGTGTGCAAGG - Intronic
935399488 2:102644978-102645000 GTCAGGAGCCACGGGGGTCAGGG - Intronic
935567890 2:104629160-104629182 GTCAGGAGGCACAGGGGTCAGGG + Intergenic
935736789 2:106112417-106112439 GGCAGGGACCCCAGTGGCCATGG + Intronic
935981043 2:108628011-108628033 TTCAGGGGTCAGAGGGGGCATGG - Intronic
936163903 2:110103851-110103873 GACAGGGGCCGGAGTGGCCAGGG + Intronic
936933668 2:117816516-117816538 TTCAGGGGCAACAATAGGCATGG + Intronic
936999909 2:118456741-118456763 GTCAGGAGGCACAGGGGTCAGGG + Intergenic
937342608 2:121100880-121100902 GGCTGGGGCCACAGCAGGCAGGG + Intergenic
937915884 2:127098512-127098534 GCCTGGGGCCACAGTGGCCTTGG - Intronic
938651715 2:133390170-133390192 GGCATGGACCACAGTGGGCCTGG - Intronic
938952254 2:136266209-136266231 GTCAGGAGGCACAGTGGTCAGGG + Intergenic
939180441 2:138796619-138796641 GTCAGGAGGCACAGGGGTCAAGG - Intergenic
940370616 2:152896557-152896579 GTCAGGAGGCACAGGGGTCACGG - Intergenic
940954519 2:159712798-159712820 GTCCGGGGCCACCGGGGCCAAGG + Intronic
941478105 2:165972455-165972477 GTCAGGAGCCACAGGGGTCAGGG - Intergenic
944094746 2:195953395-195953417 GTCAGGAGGCACAGAGGTCAGGG + Intronic
944242338 2:197499167-197499189 CTCAGGGGCCACAGTTGGAGTGG - Intronic
944963384 2:204901736-204901758 CTCAAGGGCCACAGTGAGAACGG + Intronic
945063446 2:205928191-205928213 GTCAGGGGCCATTGTTGTCAGGG - Intergenic
945803474 2:214462240-214462262 CTTAGGGCCCACAGGGGGCAAGG + Intronic
946100402 2:217315623-217315645 GGTAGGGGGCACAGTGGGCCAGG - Intronic
946210520 2:218143772-218143794 GTAGGGGGCCAGAGTGGGCTTGG + Intergenic
946277718 2:218643585-218643607 CTTAGGGGCCTCTGTGGGCAAGG + Exonic
947033569 2:225825237-225825259 GTCAGGAGGCACAGGGGTCAGGG - Intergenic
947492180 2:230604322-230604344 GTCAGGAGGCACAGGGGTCAGGG - Intergenic
947681351 2:232036983-232037005 GTCAGGAGGCACAGGGGTCAGGG + Intronic
947740939 2:232484634-232484656 GGCAGGGGCCACAGAAGACAGGG + Intronic
947742873 2:232492859-232492881 CTCAGAAGCCACAGTGGCCATGG - Intergenic
948591460 2:239053401-239053423 GTCAGTGGGCACAGTGGGGCTGG + Intronic
948884235 2:240874950-240874972 CTCAGGGGCCAGAGTGGGACCGG - Intronic
1168969310 20:1919862-1919884 GTCATGAGCCACAGGGAGCAGGG + Intronic
1169000260 20:2163292-2163314 CTGAGGGTCCACAGTGAGCAAGG + Intronic
1170454668 20:16520709-16520731 GTCAGGAGGCACAGGGGTCAGGG - Intronic
1170765083 20:19282998-19283020 GGCAGGGGCCACACAGGGAAAGG + Intronic
1171495615 20:25553037-25553059 GTGGAGGGCCACAGTGAGCAAGG - Intronic
1172017100 20:31883019-31883041 GTCATGGGGCCCACTGGGCAAGG + Intronic
1172095145 20:32456853-32456875 TTGAGGGCCCACCGTGGGCAGGG - Intronic
1172941680 20:38658684-38658706 GGCAGGGGGCAGAGTGGGCAGGG + Intergenic
1173400552 20:42722285-42722307 GGCAGTGGAGACAGTGGGCATGG - Intronic
1173725982 20:45298139-45298161 GGCATGGGACACAGTGGGCTGGG - Intronic
1175340870 20:58228378-58228400 GTCAGGGGCCAAGTCGGGCAAGG + Exonic
1175549176 20:59805615-59805637 GGCTGGGGGGACAGTGGGCAGGG + Intronic
1175862166 20:62156381-62156403 GCCAGGGGACACTGTGGGCCAGG - Intronic
1175872983 20:62217088-62217110 GTCCGGGACCCCAGTGGGGAGGG - Intronic
1176046722 20:63096775-63096797 CTGAGTGGCCACAGTGGGGATGG + Intergenic
1176112662 20:63417675-63417697 GTCAGGCCCCACAGTCCGCAGGG + Intronic
1176119379 20:63447104-63447126 GGCAGGGGCCAGAGTGGAGAGGG - Intronic
1176386554 21:6140998-6141020 TTCAGGGCCCACAGAGGGAAGGG - Intergenic
1177748533 21:25251420-25251442 GAGAGAGGCCACAGTAGGCAGGG + Intergenic
1178327784 21:31659622-31659644 GTTTGGGGCCAGAGTGGGCGAGG + Exonic
1178884766 21:36476367-36476389 CTCAGTGCCCACAGTGGGCTGGG - Intronic
1179059053 21:37962900-37962922 ATCAGAGGCCACAGTGTCCACGG - Intronic
1179736919 21:43397254-43397276 TTCAGGGCCCACAGAGGGAAGGG + Intergenic
1180012351 21:45059256-45059278 GCCAGGGGCCAGTGAGGGCAGGG - Intergenic
1180937677 22:19636918-19636940 GTCAGAGGTCACAGAGAGCAGGG - Intergenic
1181362795 22:22351513-22351535 TGCAGGGGCCACAGTGTGAAGGG + Intergenic
1181461147 22:23086639-23086661 GTCAGGGGCAACTGTGGGCTGGG - Intronic
1181762486 22:25067765-25067787 GACAGGGGCCACAGTCAGCATGG - Intronic
1181922957 22:26334792-26334814 GAGAAGGGCCAGAGTGGGCAGGG + Intronic
1183248369 22:36711055-36711077 GTCAAGGCCCTGAGTGGGCAAGG - Intergenic
1184183721 22:42849404-42849426 CTCAGTGCCCTCAGTGGGCAGGG - Intronic
1185185428 22:49396501-49396523 GGCAGGGGCTACAGTAGCCATGG - Intergenic
1185210006 22:49565350-49565372 AGCAGGGGCCACAATGGACAAGG + Intronic
949524471 3:4889507-4889529 GAGAGAGGCCTCAGTGGGCATGG - Intergenic
950008348 3:9705246-9705268 GTCAGGGGCTGCTGGGGGCAGGG - Intronic
950107081 3:10395012-10395034 GTAAGGCCCCACAGAGGGCAGGG - Intronic
950924974 3:16731363-16731385 GTCAGGAGGCACAGGGGTCAGGG - Intergenic
951795426 3:26533457-26533479 GTCAGGAGGCACAGGGGTCAGGG + Intergenic
952667235 3:35921969-35921991 GGCAGAGGCCACAATGGGCAGGG + Intergenic
952885361 3:38008476-38008498 CTCAGGGGCCCTGGTGGGCACGG - Exonic
952897235 3:38085744-38085766 GACCTGTGCCACAGTGGGCAAGG + Intronic
953613440 3:44468147-44468169 GACAGGGGACATAGTGGGAATGG - Intronic
953885694 3:46713292-46713314 GTCAAGGGCCCCAGTGGCCTGGG - Intronic
953906997 3:46873393-46873415 GGCAGGGGCCACGGAAGGCAGGG + Intronic
954379647 3:50212828-50212850 ATCAGGGGCCGGAGTGGGGATGG + Intronic
954689624 3:52388724-52388746 CCCAGGTGCCACAGTGGGTAGGG + Intronic
954952682 3:54489119-54489141 GGCAGAGGCCAGAGTGAGCAGGG + Intronic
955215675 3:56983359-56983381 GGCAGGGGTCACAGTGGGGAGGG - Intronic
955414230 3:58678061-58678083 GTCAGGAGGCACAGGGGTCAGGG + Intergenic
955439807 3:58943251-58943273 GTCAGGAGGCACAGGGGTCAGGG - Intronic
955469471 3:59271513-59271535 GTCAGGTTCCACAGTCAGCAGGG - Intergenic
955469598 3:59272859-59272881 GTCAGGTTCCACAGTCAGCAGGG + Intergenic
956177102 3:66483438-66483460 GGCTGGGTCCACAGAGGGCAGGG + Intronic
957589650 3:82179494-82179516 GCCACGAGGCACAGTGGGCATGG + Intergenic
957596552 3:82273862-82273884 GTCAGGAGGCACAGGGGTCAGGG + Intergenic
958887625 3:99745028-99745050 GTGAGGAGCAACAGAGGGCAGGG + Intronic
960261694 3:115575413-115575435 GTCAGGGGTCATGGTGGGTATGG + Intergenic
960770026 3:121183743-121183765 GTCAGGAGGCACAGGGGTCAGGG - Intronic
961657383 3:128450739-128450761 GTCAGGGACCACATGGTGCAGGG - Intergenic
961698092 3:128720375-128720397 GTCAGGGACCCCAGTGGGACTGG + Intergenic
961823729 3:129588109-129588131 GACAGAGGCCACACTGTGCAGGG + Intronic
963013905 3:140802746-140802768 GTCAGGAGGCACAGGGGTCAGGG + Intergenic
963629235 3:147712620-147712642 GTCAGGAGGCACAGAGGTCAGGG + Intergenic
963810875 3:149775166-149775188 GTCAGGGGCCACATGTGGCAAGG - Intronic
963898730 3:150712823-150712845 GTCAGGAGACACAGGGGTCAGGG - Intergenic
964049422 3:152372758-152372780 GTCAGGAGGCACAGGGGTCAGGG + Intronic
964053157 3:152420296-152420318 GTCAGGAGGCACAGGGGTCAGGG - Intronic
964367400 3:155964918-155964940 GTTAGTGCCCACAGTGGGTAAGG - Intergenic
964893240 3:161561822-161561844 CTAAGGGTCCACAGTGGGCCTGG + Intergenic
965654983 3:170974723-170974745 GTCAGGAGGCACAGGGGTCAGGG + Intergenic
966911220 3:184561576-184561598 CTCAGGGGCCGGAGTGGGCGGGG - Intronic
967141031 3:186560577-186560599 CTCTGAGGCCCCAGTGGGCATGG + Intronic
967208789 3:187148429-187148451 GTCAGAGGCTGCAGTGAGCAGGG + Intronic
967562600 3:190934479-190934501 GTCAGGAGGCACAGGGGTCAGGG + Intergenic
967715657 3:192758739-192758761 GTCAGGAGGCACAGGGGTCAGGG - Intronic
967848534 3:194063993-194064015 GTTGGGGGCCACACGGGGCATGG - Intergenic
968481412 4:834713-834735 GGCAGGGGCCAGAGACGGCAGGG + Intergenic
968541170 4:1169166-1169188 GCACTGGGCCACAGTGGGCAGGG - Intronic
968584827 4:1411444-1411466 GGCAGAGGCCAGAGAGGGCAGGG - Intergenic
968647953 4:1749334-1749356 GGGAGGGGGCACAGTGGGGAGGG - Intergenic
968736661 4:2300801-2300823 TTCAGAGGGAACAGTGGGCACGG - Intronic
968829034 4:2922599-2922621 GTCAGGAGGCACAGGGGTCAGGG + Intronic
968866044 4:3212585-3212607 GGCCCGGGCCAGAGTGGGCAGGG - Exonic
969291031 4:6240146-6240168 GTCAGAGGCCGCAGTGGGAGAGG + Intergenic
969428766 4:7140838-7140860 TGCAGGGGACACAGCGGGCATGG + Intergenic
969461697 4:7332500-7332522 GTCGGGGGTCACAGTGGGTCGGG - Intronic
969676432 4:8616871-8616893 GTCACGAGCCCCAGAGGGCAGGG + Intronic
969909126 4:10427531-10427553 GTCAGGAGGCACAGGGGTCAGGG + Intergenic
970412115 4:15818532-15818554 GTCAGGAGACACAGGGGTCAGGG - Intronic
970934626 4:21554641-21554663 GTGAGGGGGCACACTGGGGAAGG - Intronic
971673543 4:29595159-29595181 GTCAGGAGGCACAGTGGTCAGGG + Intergenic
973321877 4:48818101-48818123 GTCAGGAGGCACAGAGGTCAGGG - Intronic
974562730 4:63542076-63542098 GGCAGGGGCCACAAAAGGCAGGG - Intergenic
975096701 4:70464928-70464950 GTCAGGAGGCACAGGGGTCAGGG - Intronic
975245928 4:72120435-72120457 GTCAGGGGACTCAGGGGTCAGGG - Intronic
975404665 4:73976181-73976203 GGCAGTGGCTACAGTGGGCTGGG + Intergenic
975424915 4:74214669-74214691 GTCAGGAGGCACAGGGGTCAGGG + Intronic
976215428 4:82711272-82711294 GTAGGGGGTCACAGTGGGGAGGG - Intronic
976370868 4:84286612-84286634 GTCAGGAGGCACAGGGGTCAGGG - Intergenic
976852827 4:89568047-89568069 GTCAGGAGGCACAGGGGTCAGGG + Intergenic
977632917 4:99263275-99263297 GTCAGGAGGCACAGGGGTCAGGG + Intergenic
977887948 4:102273626-102273648 GTCAGGAGGCACAGGGGTCAGGG - Intronic
978179475 4:105775809-105775831 GTCAGGAGGCACGGTGGTCAGGG + Intronic
979461555 4:120990155-120990177 GTCAGGAGGCACAGGGGTCAGGG + Intergenic
980037774 4:127904934-127904956 GTCAGGCTACACAGTGGTCAGGG + Intergenic
981481407 4:145242955-145242977 GTCAGGAGGCACAGGGGTCAGGG + Intergenic
982060211 4:151597489-151597511 GTCAGGAGGCACAGGGGTCAGGG + Intronic
982547239 4:156749266-156749288 GACAGGATGCACAGTGGGCATGG + Intergenic
984709874 4:182876115-182876137 CTCAGGGTCCAGAGTGGGCCAGG + Intergenic
985746570 5:1651786-1651808 GGGGGGGGCCACAGAGGGCAGGG + Intergenic
985949976 5:3215507-3215529 CTCAGGGATCACACTGGGCATGG + Intergenic
986343055 5:6808685-6808707 ACCAGGGGCCACAGTTGCCACGG + Intergenic
986396260 5:7333588-7333610 CACAGGGGCCAAAGTGAGCATGG - Intergenic
986430238 5:7674046-7674068 GGCAGGGGCCTCAGAGGGTAGGG + Intronic
986438398 5:7757731-7757753 GTCAGGGCTCACAGCAGGCAGGG + Intronic
986497966 5:8365574-8365596 GTCACAAGCAACAGTGGGCATGG + Intergenic
986920464 5:12673729-12673751 GTCAGGAGGCACAGGGGTCAGGG + Intergenic
987962093 5:24823855-24823877 GGCAGGGGCCACAATGCTCAGGG + Intergenic
988588147 5:32525694-32525716 GTCAGGGGCCACAGCAGGAAGGG - Intergenic
990955238 5:61333125-61333147 GTCCGGGGCGACGGGGGGCAGGG - Intronic
992077931 5:73207749-73207771 GTCAGGAGGCACAGGGGTCAGGG - Intergenic
992166189 5:74054311-74054333 GTCAGGGGCCATGGTGGCTATGG - Intergenic
993402751 5:87473256-87473278 GTCAGGAGGCACAGGGGTCAGGG - Intergenic
994142796 5:96360792-96360814 GTCAGGAGGCACAGGGGTCAGGG + Intergenic
994671105 5:102762810-102762832 GGCAGGGGCCACAGAGGAAATGG - Intronic
995398639 5:111716651-111716673 GTCAGGAGACACAGGGGTCAGGG + Intronic
996683725 5:126257218-126257240 GGCATGGACTACAGTGGGCAGGG - Intergenic
996910820 5:128655432-128655454 GTCAGGAGGCACAGCGGTCAGGG + Intronic
997235751 5:132271161-132271183 GTCAGGGGTCAGAGTGGGACTGG - Intronic
997538050 5:134638037-134638059 GTCAAGGCCCCCAGTGGGCTAGG - Intronic
997771126 5:136555635-136555657 GTTAGGGTCCACAGTGGCAAGGG + Intergenic
998118192 5:139554909-139554931 GTCAGGTGAAGCAGTGGGCACGG + Intronic
998145442 5:139725163-139725185 GTCAGGGGGCACAGTCTGCATGG - Intergenic
998845331 5:146303132-146303154 TACAGGGGCCACAGGAGGCATGG - Intronic
999188060 5:149727556-149727578 GTCAGGGGCCAGGCTGGGCCTGG + Intergenic
999896425 5:156038930-156038952 GTCAGAGGCCAAACTGAGCAGGG - Intronic
1001562178 5:172677039-172677061 GTCAGTGGCCACGGTGGGGGAGG + Intronic
1002102060 5:176862574-176862596 GCCAGGGGCCAGACTGGGCAGGG - Intronic
1002103477 5:176868719-176868741 GGCAGGGGCCACTCTGGGCAGGG + Intronic
1002259926 5:177985813-177985835 CTCAGGGGCGAGTGTGGGCAGGG + Intergenic
1002685853 5:181008708-181008730 GTCAGGTGACACAGGGGTCAGGG - Intergenic
1003201362 6:3964375-3964397 GTGTGTGGCCACAGTGGGAAGGG + Intergenic
1003468937 6:6410333-6410355 GTCAGGAGTGGCAGTGGGCAAGG - Intergenic
1003501874 6:6709952-6709974 TCCAGGAGCCACAGTGGGAATGG + Intergenic
1004028051 6:11837874-11837896 GTCAGGAGGCACAGGGGTCAGGG - Intergenic
1004593279 6:17074111-17074133 GTCAGGAGGCACAGGGGTCAGGG - Intergenic
1004626166 6:17379309-17379331 GAGAGGGGCCACAAAGGGCATGG + Intergenic
1005208483 6:23432283-23432305 GTCAGGAGGCACAGGGGTCAGGG + Intergenic
1005274251 6:24199189-24199211 GTCAGGAGGCACAGGGGTCAGGG - Intronic
1006042651 6:31268995-31269017 GACAGGGGTCACGGTGGACACGG + Exonic
1006060410 6:31414583-31414605 GGCAGAGCCCACAGTGGGCAGGG + Intronic
1006072855 6:31509355-31509377 GGCAGGGCCCACAGTGGGCAGGG + Intronic
1006377180 6:33678081-33678103 GTCAGGAGCCAGGGTGGGCCTGG - Intronic
1006706929 6:36028288-36028310 GCCTGGGGCCGCTGTGGGCAGGG + Intronic
1006911773 6:37567901-37567923 GCCTGGGGACACACTGGGCATGG + Intergenic
1007409650 6:41654342-41654364 GGCAGGGCCCCCAGAGGGCAGGG - Intergenic
1007655631 6:43449602-43449624 TTCAGGGACCCCAGTGGTCAGGG + Intronic
1007832016 6:44646103-44646125 GCCAGGGGCTACAGGGGACATGG - Intergenic
1009570242 6:65375063-65375085 GTCAGGAGGCACAGGGGTCAGGG - Intronic
1010276402 6:73972780-73972802 GTCAGGAGGCACAGGGGTCAGGG - Intergenic
1010792074 6:80075981-80076003 GCCACTGGCCACAGTGGGCAGGG + Intergenic
1012043473 6:94239363-94239385 GTCAGGAGGCACAGGGGTCAGGG - Intergenic
1012173370 6:96047658-96047680 GTCAGGGGCTAGAGTAGGGAAGG - Intronic
1012314335 6:97767203-97767225 GTCAGGGGGCAGGGTGGGGAGGG - Intergenic
1012922344 6:105233452-105233474 GTCAGGAGGCACAGGGGTCAGGG + Intergenic
1013956982 6:115852982-115853004 GTCAGGAGGCACAGGGGTCAGGG - Intergenic
1014223479 6:118822578-118822600 GTCAGGAGGCACAGGGGTCAGGG + Intronic
1014737837 6:125115036-125115058 GGCAGTGGCCCCACTGGGCAAGG + Intergenic
1014868287 6:126559127-126559149 GTCAGGAGGCACAGGGGTCAGGG - Intergenic
1015802134 6:137070810-137070832 GTCAGGAGGCACAGGGGTCAGGG - Intergenic
1016334925 6:142994459-142994481 GTCAGGGTACACAGGGGTCAGGG - Intergenic
1016483435 6:144507724-144507746 GTCAGGAGGCACAGGGGTCAGGG + Intronic
1016809681 6:148247839-148247861 GGGAGGGGCCAGAGTGGCCAGGG - Intergenic
1017039482 6:150296243-150296265 TTCTGGGGCCTCAGCGGGCATGG - Intergenic
1017124355 6:151051777-151051799 GGCAGAGACCACAGTGGGCAGGG + Intronic
1017571476 6:155749267-155749289 GTCAGGAGGCACAGGGGTCAGGG - Intergenic
1017980835 6:159400076-159400098 TTCAGGGGACACAGGGTGCATGG + Intergenic
1018620278 6:165724121-165724143 GACAGGGCACACACTGGGCATGG + Intronic
1018855067 6:167669220-167669242 GGCAGGGGCCACAGAGAGCAGGG + Intergenic
1019071846 6:169353333-169353355 GTCAGGAGGCACAGGGGTCAGGG + Intergenic
1019145410 6:169972560-169972582 GTCAGTGGCCACCATGGGAAAGG + Intergenic
1019171100 6:170133591-170133613 GGCAGGTGCCTCAGTGGGTAGGG + Intergenic
1019171569 6:170136093-170136115 GTCCGGGGACACCGTGGGCCTGG - Intergenic
1019257368 7:60896-60918 GGCAGGGCCCACGGTGGGCCTGG + Intergenic
1020753361 7:12170321-12170343 GTCAGGAGGCACAGGGGTCAAGG + Intergenic
1021509841 7:21424089-21424111 GTCAGGGGCTGCAGTGAGCCGGG - Intergenic
1022040526 7:26577240-26577262 GTCACAGGCCACCTTGGGCAAGG - Intergenic
1022465307 7:30649394-30649416 GCTTGGGGCCACTGTGGGCATGG + Intergenic
1022544462 7:31173262-31173284 GCCAGGACCCACAGAGGGCAGGG + Intergenic
1022789640 7:33674044-33674066 GCCAGGGCACACAGAGGGCACGG - Intergenic
1022884499 7:34628787-34628809 GTCAGGAGGCACAGAGGTCAGGG - Intergenic
1023208092 7:37773156-37773178 GGCAGGGGGCAGAGTGGGAATGG - Intronic
1023511567 7:40959127-40959149 GTCAGGAGGCACAGGGGTCAGGG + Intergenic
1024283737 7:47739473-47739495 GACCTGGGCCACAGTGGGGACGG + Intronic
1024285946 7:47757686-47757708 GTCAGGGGAGAAAGTGGCCAAGG + Intronic
1024469294 7:49750462-49750484 GGCAGAGGTCACAGTGGGCTGGG + Intergenic
1024797351 7:53035825-53035847 GTCAGGGACCTCAGGGGCCAGGG - Exonic
1025206529 7:56996307-56996329 GGCAGGAGCCACAGTGGGAAGGG + Intergenic
1025665409 7:63580620-63580642 GGCAGGAGCCACAGTGGGAAGGG - Intergenic
1026873673 7:73868003-73868025 GTTTGGGGCCAAAGTGGGGATGG + Intergenic
1026942537 7:74295590-74295612 GCCAGGGGCCACAGAGGAGAGGG + Intronic
1028337385 7:89674218-89674240 GTCAGGAGGCACAGGGGTCAGGG - Intergenic
1028648323 7:93122017-93122039 GTCAGGAGGCACAGGGGTCAGGG - Intergenic
1028756867 7:94445884-94445906 GTCAGGGGACACTGTGGTTAAGG - Intergenic
1029580923 7:101436177-101436199 GACAGTGGGCCCAGTGGGCAGGG - Intronic
1031031866 7:116743715-116743737 GTCAGGAGGCACAGGGGTCAGGG - Intronic
1032080528 7:128856383-128856405 GGCAGGGGCCAGGCTGGGCATGG + Intronic
1032091576 7:128914167-128914189 GGCAGGGGCCAGGCTGGGCATGG - Intergenic
1033056338 7:138058409-138058431 GGCAGGGGCCGTAGTGGGTAGGG - Intronic
1033201103 7:139371039-139371061 GTCACGTGTCACAGTGGGCTTGG - Intronic
1035255358 7:157622474-157622496 GGAACGGGCCCCAGTGGGCAGGG - Intronic
1035685438 8:1520460-1520482 GTCAGGGGTCACGCTTGGCATGG + Intronic
1036188071 8:6642696-6642718 GTCAGGACACTCAGTGGGCAGGG - Intronic
1036767526 8:11558215-11558237 GGCAGGAGGCACAGTGGCCAGGG - Intronic
1037179821 8:15992287-15992309 GTCAGTGGCAGCAGTGGGCCAGG + Intergenic
1038403587 8:27305375-27305397 CTCAGGAGCCTCAGTGTGCAGGG + Intronic
1038455978 8:27672183-27672205 CTCAGGGGGCACTGTGTGCAAGG - Exonic
1039133910 8:34298251-34298273 GTCAGGAGGCACAGGGGTCAGGG - Intergenic
1039754779 8:40511898-40511920 GTCAGGAGGCACAGGGGTCAGGG + Intergenic
1040802695 8:51361062-51361084 AGCAGTGGCCACAGTGGGCCTGG - Intronic
1040976700 8:53201159-53201181 GTCAGGAGGCACAGGGGTCAGGG + Intergenic
1041050873 8:53932802-53932824 GTCAGGAGGCACAGGGGTCAGGG - Intronic
1042837300 8:73090464-73090486 CCCAGGAGCCACAGTCGGCATGG + Intronic
1044035072 8:87291654-87291676 GTGAGGGGGCACAGGGGACAAGG + Intronic
1044131154 8:88525868-88525890 GTCAGGAGGCACGGGGGGCAGGG - Intergenic
1046124150 8:109883075-109883097 TTCAATGGCCACATTGGGCATGG + Intergenic
1046665729 8:117000341-117000363 GTCAGGGCCCACAGTGAGGGTGG - Intronic
1046832759 8:118764337-118764359 GGCAGTGGACACAGTGGGCCTGG - Intergenic
1047121373 8:121908609-121908631 GTCAGGAGCCACAGGGGTCAGGG - Intergenic
1047385821 8:124408249-124408271 GACAGGGGCCAGAGAGGCCATGG - Intergenic
1047965406 8:130042630-130042652 GTCAGGTGGCACAGTGGCCTGGG - Intergenic
1049034191 8:140061767-140061789 GTCAGGGCCCACGTTGGGAAGGG + Intronic
1049389078 8:142358925-142358947 CACAGGGGCCACTGTGGGCTGGG - Intronic
1050368967 9:4901544-4901566 GTCAGGAGACACAGGGGTCAAGG + Intergenic
1050943097 9:11485212-11485234 GTCAGGAGGCACAGGGGTCAGGG + Intergenic
1051156751 9:14156616-14156638 GGCAGGGTCCACAGTGGCCATGG + Intronic
1051606702 9:18923837-18923859 GACAGGTACCACAGAGGGCAGGG + Intergenic
1051863328 9:21651313-21651335 GTCAGGAGGCACAGGGGTCAGGG + Intergenic
1051982976 9:23046375-23046397 GTCAGGAGGCACAGGGGTCAGGG - Intergenic
1052506427 9:29359621-29359643 GTCAGGAGGCACAGGGGTCAGGG - Intergenic
1052780761 9:32780389-32780411 GTCAGCAGCAACAGTGGGTAGGG - Intergenic
1054985920 9:71261964-71261986 GTCAGGAGCCACAGGGACCAGGG + Intronic
1056302572 9:85257608-85257630 GTCAGGAGGCACAGGGGTCAGGG + Intergenic
1056385084 9:86090206-86090228 GTCAGGAGGCACAGGGGTCAGGG + Intronic
1056788144 9:89606972-89606994 CTCAGGGACCACAAAGGGCAGGG - Intergenic
1057172272 9:92969968-92969990 GGCTGAGTCCACAGTGGGCACGG + Intronic
1057512365 9:95691491-95691513 CTCAGGGGCCAAAGTGGCCATGG - Intergenic
1057604593 9:96489852-96489874 GGCAGGACCCACAGTGGGAAGGG - Intronic
1057910456 9:99016082-99016104 TTCAGGAGCCACTGTGGGCAGGG - Exonic
1058408528 9:104704140-104704162 GTCAGGAGGCACAGGGGTCAGGG - Intergenic
1059345096 9:113623059-113623081 ATCAGGGGGCCCAGTGGGCTGGG - Intergenic
1060822556 9:126669896-126669918 GACAGGAACCACAGTGGCCATGG + Intronic
1061133699 9:128721807-128721829 CTCAGGGGCTGCTGTGGGCATGG + Exonic
1061209462 9:129182426-129182448 GTCAGGGCCCACTGTGGACCCGG - Intergenic
1061393204 9:130329165-130329187 GTCAGGGGCTGCAGTGGGGCTGG - Intronic
1061434967 9:130555311-130555333 CTCAGGGGCTCCAGTGGACAAGG + Intergenic
1061537378 9:131258467-131258489 GTCAGGGGGCAAGGTGGGCTGGG + Exonic
1061616749 9:131785318-131785340 GACAGGGGGCAGAGGGGGCAGGG + Intergenic
1061670800 9:132187140-132187162 CAGGGGGGCCACAGTGGGCATGG - Intronic
1062084040 9:134639455-134639477 ATCAGGGGCCACAGAGGGTAGGG - Intergenic
1062124408 9:134851338-134851360 GTCAGAGCCCACAGCGGGCTGGG + Intergenic
1062151675 9:135022525-135022547 GGCAGGCGCCACAGTGGCCCAGG + Intergenic
1062414286 9:136439879-136439901 GCCAGGGGCCGCTGTGGGCGGGG - Intergenic
1062460024 9:136659135-136659157 GTCAGGGGCCGGAGCAGGCAGGG + Exonic
1062519780 9:136952836-136952858 GGCAGGGGTGGCAGTGGGCAGGG - Intronic
1062519786 9:136952852-136952874 GGCAGGGGCGGCGGTGGGCAGGG - Intronic
1185891410 X:3825434-3825456 GGTCGGGGCCACAGAGGGCACGG + Intronic
1185896517 X:3863848-3863870 GGTCGGGGCCACAGAGGGCACGG + Intergenic
1185901635 X:3902274-3902296 GGTCGGGGCCACAGAGGGCACGG + Intergenic
1186349315 X:8727328-8727350 TGCAGGGACCATAGTGGGCAGGG - Intronic
1186960889 X:14735695-14735717 GTCAGGAGGCACAGAGGTCAGGG + Intergenic
1189937827 X:46087801-46087823 GTCAGGAGGCACAGGGGTCAGGG - Intergenic
1190118177 X:47639198-47639220 AGCAGGGGCCACATTTGGCATGG + Exonic
1190211482 X:48452078-48452100 TTCAGTGGCCACAGAGGACAAGG + Intergenic
1190251556 X:48730891-48730913 GCCAGGGGCCAGTGTGGGCTTGG - Intergenic
1190747208 X:53331623-53331645 GCCAGGGGCAACAGTGGCCGGGG - Intergenic
1190943902 X:55072514-55072536 GTCAGGAGGCACAGGGGTCAGGG + Intergenic
1191872882 X:65764838-65764860 GTCAGGAGGCACAGAGGTCAGGG + Intergenic
1191962551 X:66719289-66719311 GTCAGGTGTCACAGGGGTCAGGG - Intergenic
1192237072 X:69302769-69302791 AGCAGGGGCCTCAGTGGGCAAGG + Intergenic
1192499376 X:71639459-71639481 GTCAGAGGACACTGTTGGCAAGG - Intergenic
1192694799 X:73402045-73402067 GTCAGGAGACACGGTGGTCAGGG - Intergenic
1192755766 X:74046062-74046084 GTCAGGAGGCACAGGGGTCAGGG + Intergenic
1192915989 X:75651920-75651942 GTCAGGAGGCACAGGGGTCAGGG + Intergenic
1193040395 X:76998441-76998463 GTCAGGAGGCACAGGGGTCAGGG + Intergenic
1193793647 X:85846864-85846886 GTCAGGAGGCACAGGGGTCAGGG + Intergenic
1193830065 X:86279223-86279245 GTCAGGAGGCACAGGGGTCAGGG - Intronic
1194021318 X:88695195-88695217 GTCAGGAGGCACAGGGGTCAGGG - Intergenic
1194203066 X:90978591-90978613 GTCAGGAGGCACAGTTGTCAGGG + Intergenic
1194954352 X:100162057-100162079 GTCAGGAGGCACAGGGGTCAGGG + Intergenic
1196960159 X:120992511-120992533 GTCAGGAGGCACAGGGGTCAGGG + Intergenic
1198062655 X:133062439-133062461 GTCAGGAGGCACAGGGGTCAGGG - Intronic
1198117629 X:133559403-133559425 GCCAGGTGCCATAGTGGGTACGG + Intronic
1198758081 X:140001577-140001599 GTCAGGAGGCACAGTGGTCATGG - Intergenic
1199347767 X:146761589-146761611 ACCAGGGGCTTCAGTGGGCATGG - Intergenic
1199452153 X:147989462-147989484 GTCAGGAGGCACAGGGGTCAGGG + Intronic
1199848913 X:151711399-151711421 GTCAGAGGCTACAGAGGCCAGGG + Intergenic