ID: 1121608452

View in Genome Browser
Species Human (GRCh38)
Location 14:95258874-95258896
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1392
Summary {0: 2, 1: 3, 2: 50, 3: 254, 4: 1083}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900321773 1:2088055-2088077 TTTCTCTGCTGTGTGGGTGGGGG + Intronic
900372363 1:2337640-2337662 GCTCTGATGTGTGTGTGTGGAGG - Intronic
900683201 1:3929552-3929574 TGTGTGTGGTGTGTGTGGTGTGG - Intergenic
900683211 1:3929669-3929691 TGTGTGTGGTGTGTGTGGTGTGG - Intergenic
900913800 1:5620417-5620439 TCTCTTTGGGGTGTGTGTGGTGG + Intergenic
900953678 1:5873976-5873998 TATGTGAGGTGTGTGTGCAGGGG - Intronic
900995541 1:6121449-6121471 GGCCTGTGGTGTGTGTGGGGTGG - Intronic
901157075 1:7148319-7148341 AGTGTGTGGTGTGTGTGTGGGGG - Intronic
901312061 1:8276928-8276950 TGTGTGTGGTGTATGTGTGTGGG - Intergenic
901407670 1:9060550-9060572 TATGTGTGTGGTGTGTGTGTGGG - Intronic
901407688 1:9060652-9060674 TGTGTGGGGTGTGTGTGTGTGGG - Intronic
901436574 1:9250490-9250512 GGCCTGTGGTGTGTGTGGGGTGG - Intronic
901799930 1:11702440-11702462 TATGTGTGTTGTGAGTGTGTAGG - Intronic
902116564 1:14126126-14126148 TATGTGGACTGTGTGTGTGGTGG + Intergenic
902584680 1:17431377-17431399 TATATGTGGGCTGGGTGTGGTGG + Intronic
902728966 1:18356280-18356302 TCTCTGGGGTGTGTGTGGTGGGG - Intronic
902728968 1:18356282-18356304 GCTCTCTGGGGTGTGTGTGGTGG - Intronic
902801140 1:18831007-18831029 CATCTGTGGGGTGTGTGGGGTGG - Intergenic
903062814 1:20682105-20682127 TATGTGTTGTGTGTGTGTGTGGG - Intronic
903303484 1:22395643-22395665 TCTGTGTGGGGTGTGTGCGGGGG + Intergenic
903642570 1:24869994-24870016 TCTCTGTGGTTTGTTAGTGGCGG - Intergenic
903771611 1:25767859-25767881 TATGTGAGGGGAGTGTGTGGGGG - Intronic
903771788 1:25768873-25768895 TATGTGTGTGGTGTGTGTGAGGG - Intronic
903852300 1:26315469-26315491 TGTCTTTGGTGTGCCTGTGGGGG - Intronic
903968887 1:27106398-27106420 TAAATGTGATGGGTGTGTGGGGG + Intronic
904497271 1:30893970-30893992 TGTGTGTGGTGTGTGTGTGGAGG - Intronic
905120890 1:35681043-35681065 GAACAGTTGTGTGTGTGTGGGGG - Intergenic
905804831 1:40868854-40868876 TATCTGCGGTGTGTGTGTGGTGG + Intergenic
905826728 1:41031332-41031354 TAACAGGTGTGTGTGTGTGGTGG - Intronic
905874736 1:41424997-41425019 TATGTATGTTGTGTGTGTGGTGG + Intergenic
905944262 1:41888712-41888734 TGTGTGTGGTATGTGTGTGGGGG - Intronic
906412021 1:45586141-45586163 TATATGTGCTGGGTGTGTGGGGG + Intronic
907256992 1:53186856-53186878 TCTCAGTGATGTGTGTGTGAGGG + Intergenic
907311089 1:53539547-53539569 GATGTGTAGTGTGTGTGGGGGGG - Intronic
907597931 1:55736904-55736926 TATCTGATGTGTTTGGGTGGTGG - Intergenic
908092880 1:60705018-60705040 TATTGTTTGTGTGTGTGTGGTGG - Intergenic
908461126 1:64349074-64349096 TGTGTGTGATGTGTGTGTTGGGG + Intergenic
908582807 1:65534887-65534909 TATCTGTTTTGTGAGGGTGGAGG + Intronic
908986289 1:70027112-70027134 TATCTGTGGAAAGTGTGTGTGGG - Intronic
910342616 1:86204972-86204994 TGTGTGTGGTGTGTGTGTGTGGG - Intergenic
910611239 1:89144724-89144746 TTTTTTTTGTGTGTGTGTGGTGG + Intronic
910834714 1:91497132-91497154 TTTTTTTGGTGTGTGTGTGGGGG + Intergenic
911037462 1:93566003-93566025 TTACTCTGGTGTCTGTGTGGAGG - Intronic
912450005 1:109762924-109762946 TAAATGTGGTGTGTGTGTCCCGG + Intronic
912684241 1:111749400-111749422 TAACTATGCTGTGTGTGTTGGGG + Intronic
912791579 1:112657210-112657232 TGTGTGTGTTGTGTGTGTGTAGG + Intronic
913324618 1:117615856-117615878 TATCTTTGGTGTGTATGGTGGGG + Intronic
913437169 1:118859157-118859179 TATCTGTGGTGAGTGTGTGAGGG - Intergenic
915040551 1:152964905-152964927 TATGTGTGGTGTCTGTGGAGTGG - Intergenic
915059871 1:153172494-153172516 TATCTCTGGGGTCTCTGTGGGGG - Intergenic
915101994 1:153507392-153507414 TTCCTTGGGTGTGTGTGTGGGGG - Intergenic
915619122 1:157068783-157068805 TGTGTGGGGGGTGTGTGTGGGGG - Intergenic
915619124 1:157068785-157068807 TATGTGTGGGGGGTGTGTGTGGG - Intergenic
915943513 1:160134074-160134096 TGTGTGAGATGTGTGTGTGGGGG - Intronic
916418855 1:164617609-164617631 TCTCAGAGGGGTGTGTGTGGTGG + Intronic
916525767 1:165607701-165607723 TGTGTGTGATGTGTGTGTGTGGG - Intergenic
916724432 1:167510161-167510183 TATGTATGGTGTGTGTGTTTAGG - Intronic
917239852 1:172936427-172936449 TATTTTGGGTGTGTGTGTGAGGG - Intergenic
917902014 1:179552073-179552095 TAACTGAGGTGTGGGTGAGGGGG - Intronic
918117367 1:181508729-181508751 CGTCTGTGGTGTGTGTCTGCTGG + Intronic
918395638 1:184110915-184110937 TATATGTGGGAGGTGTGTGGGGG - Intergenic
918825651 1:189320422-189320444 TCTGTGTGGTGTGTGTGTAGGGG - Intergenic
918825653 1:189320424-189320446 TCTCTGTGTGGTGTGTGTGTAGG - Intergenic
919092612 1:192992912-192992934 AATCTGTGGCTTGGGTGTGGTGG - Intergenic
919303158 1:195795894-195795916 CATCATTGGTGTGTGTGTGTGGG + Intergenic
919493554 1:198236027-198236049 TCTCTGTGGAGTGACTGTGGAGG + Intronic
919928286 1:202204399-202204421 TGTGTGTGGTGTGTGTTTGGAGG - Intronic
919977840 1:202624228-202624250 TATGTGTAGTGTGTGTGATGTGG + Intronic
919983100 1:202654648-202654670 GATCTGATGTGTGTGTGTGTTGG - Intronic
920102638 1:203526969-203526991 TAGGTGTGGTATGTGAGTGGAGG - Intergenic
920227084 1:204446819-204446841 TGCGTGTGTTGTGTGTGTGGGGG - Intronic
920440027 1:205974326-205974348 GGTGTGTGGTGTGTGTGTGGAGG - Intergenic
920444343 1:206004137-206004159 TGTGTGTGGTGTGTATGTGCGGG - Intergenic
920444350 1:206004207-206004229 TGTGTGTGGTGTGTATGTGTGGG - Intergenic
920491474 1:206418971-206418993 TATGTTGGATGTGTGTGTGGTGG - Intronic
920571327 1:207020248-207020270 TATGTGAGGTGTGGGTGTGGCGG - Exonic
920571528 1:207021728-207021750 TGTGTTTGGTGTGTGTGTGGAGG - Exonic
920634715 1:207689372-207689394 TGTGTGTGGTGTGTGTGTGCAGG + Intronic
920811876 1:209293557-209293579 TATATGTGGTTTGTGTGGGTGGG + Intergenic
921183627 1:212651818-212651840 AATGTGTGGTGTGAGTCTGGAGG - Intergenic
921478866 1:215640673-215640695 TGTCTGTGGTGTGTGTGAACTGG - Exonic
922227110 1:223655010-223655032 TATGTGTGGTGTGGGTGTGTGGG + Intronic
922618756 1:226978221-226978243 TGTGTGTGGTGGGTGTGTAGAGG - Intronic
922618830 1:226978544-226978566 TGGCTGTGGGGGGTGTGTGGAGG - Intronic
922618912 1:226978920-226978942 GGTGTGTGGTGGGTGTGTGGAGG - Intronic
922695517 1:227729055-227729077 TATCTGGGGTGTGCGTCTGCAGG + Intronic
922866293 1:228863979-228864001 TATCCGGTGTGTGTGTGTTGGGG + Intergenic
923185580 1:231569776-231569798 GATCTTGGGTGTGTCTGTGGGGG - Intronic
923419806 1:233801382-233801404 TAGCTCTTGTGTGTGTGTGTTGG - Intergenic
923808289 1:237284709-237284731 AAACTGTGCTGTGTGTGTGGGGG - Intronic
924659926 1:246006763-246006785 TAGCTGTGGGGTCTGCGTGGAGG - Intronic
1062831355 10:608167-608189 TGTGTGGGGTGTGTGTGGGGGGG - Intronic
1062831357 10:608169-608191 TGTGTGTGGGGTGTGTGTGGGGG - Intronic
1062831561 10:608716-608738 TTGAAGTGGTGTGTGTGTGGGGG - Intronic
1063171689 10:3515314-3515336 TCTAGCTGGTGTGTGTGTGGTGG - Intergenic
1063180468 10:3593803-3593825 TGTGTGTGCTGTGTGTGAGGGGG + Intergenic
1063200555 10:3782644-3782666 TATCTGTGGAGTGTGAAGGGTGG - Intronic
1063353989 10:5381177-5381199 TGTGTGTGGTGTGTGTGTGTGGG - Intergenic
1063354046 10:5381489-5381511 TGTGTGGGGTGTGTGTGTGGTGG - Intergenic
1063379791 10:5577225-5577247 TGTGTGTGGGGTGTGTGTGTGGG - Intergenic
1063379823 10:5577389-5577411 TGTGTGGGGTGTGTGTGTGGGGG - Intergenic
1063379825 10:5577391-5577413 TGTGTGTGGGGTGTGTGTGTGGG - Intergenic
1063379831 10:5577417-5577439 TGTGTGGGGTGTGTGTGTGCGGG - Intergenic
1063379884 10:5577683-5577705 TGTGCGGGGTGTGTGTGTGGGGG - Intergenic
1063379891 10:5577710-5577732 TGTGCGGGGTGTGTGTGTGGGGG - Intergenic
1063379908 10:5577780-5577802 TGTGTGGGGTGTGTGTGTGTGGG - Intergenic
1063494182 10:6491473-6491495 TTTCTGGGATGTGTGGGTGGGGG + Intronic
1063524072 10:6767998-6768020 TGTCTGGTGTATGTGTGTGGTGG + Intergenic
1064114181 10:12563505-12563527 TATTTCTGGTGTGTCTGTGAGGG - Intronic
1064927958 10:20590999-20591021 TACCTCTTGTGCGTGTGTGGAGG + Intergenic
1065412495 10:25444534-25444556 TGTGTGTGTGGTGTGTGTGGAGG + Intronic
1065706473 10:28475640-28475662 TATTTTTGGTGTGTCTGTGAGGG + Intergenic
1066129634 10:32380089-32380111 TGTGTGTGGTGTGTGTGGGGAGG - Intergenic
1067013041 10:42732339-42732361 TATGTGTGTGGTGTGTGTGTGGG - Intergenic
1067013052 10:42732397-42732419 TGTGTGTGGTGTGTGTGGGTGGG - Intergenic
1067310795 10:45111750-45111772 TGTATGTGTGGTGTGTGTGGGGG + Intergenic
1067310806 10:45111796-45111818 TGTGTATGGGGTGTGTGTGGGGG + Intergenic
1067414529 10:46093460-46093482 TGTGTGTGGTGTGTGTGTATGGG - Intergenic
1067434591 10:46268002-46268024 TGTGTGTGGTGTGTGTGTATGGG - Intergenic
1067434618 10:46268194-46268216 TATGTGTTGTATGTGTGTGGGGG - Intergenic
1067469460 10:46525490-46525512 TGTGTGTGATGTGTGTGTGTGGG - Intergenic
1067523333 10:47024029-47024051 TATGTGCGGTGTGTGTGGTGTGG - Intergenic
1067593817 10:47536593-47536615 TAGTTATGTTGTGTGTGTGGTGG - Intronic
1067640929 10:48044702-48044724 TAGTTATGTTGTGTGTGTGGTGG - Intergenic
1067678505 10:48409082-48409104 TGTGTGGGGTGTGTGTGTGAGGG + Intronic
1067974697 10:51011189-51011211 TATTTGTTGTGTGTGTGTGTGGG + Intronic
1068843430 10:61642163-61642185 TGATTGTGGTGTGTGTGTGTTGG - Intergenic
1068929092 10:62570180-62570202 AATCTGTATTGTGTTTGTGGTGG + Intronic
1068942729 10:62695669-62695691 CAACTGGTGTGTGTGTGTGGCGG - Intergenic
1069457744 10:68567119-68567141 TATCTGTGGTTTGAGTGTCAGGG - Intronic
1069607960 10:69752075-69752097 TGTCTGTGTGGCGTGTGTGGTGG + Intergenic
1070175510 10:73966180-73966202 AACCTGTGGTGTGTGCGGGGAGG - Intergenic
1070648163 10:78215769-78215791 TAACTGTGGCGCGTGAGTGGGGG - Intergenic
1070711460 10:78686188-78686210 TGGATTTGGTGTGTGTGTGGGGG - Intergenic
1070765456 10:79053694-79053716 TGTGTGTGGTATGTGTGTTGGGG + Intergenic
1070858962 10:79633647-79633669 TGTGTGTGTGGTGTGTGTGGGGG - Intergenic
1071017474 10:81015046-81015068 TGTGTGTGATGTGTGTGAGGGGG + Intergenic
1071209787 10:83326803-83326825 CATGTGTTGTGTGTGTGTTGGGG + Intergenic
1071290680 10:84186557-84186579 GATGTGTGGTGTGTGTGTGAGGG + Intergenic
1071328990 10:84542220-84542242 TGTGTGTGGTGTATGTGTGTAGG + Intergenic
1071445527 10:85742926-85742948 TATTTGTGGGTTGGGTGTGGGGG + Intronic
1072387170 10:94942504-94942526 TATTTGTGCTGTGTGTGTACAGG + Intronic
1073043416 10:100622292-100622314 TGTCTGTGGTGTGTGCAGGGTGG + Intergenic
1073539152 10:104304163-104304185 TGTTTGGTGTGTGTGTGTGGTGG - Intronic
1074164199 10:110860265-110860287 TATCTATGTGGTGTGTATGGGGG + Intergenic
1074399496 10:113129999-113130021 GGTGTGTGGTGTGTGTATGGGGG + Intronic
1074545932 10:114402850-114402872 AAGCTGGGGTGTGTGTATGGGGG - Intronic
1074606405 10:114973105-114973127 TATCTGTGTTGTGTTTCTGCAGG + Intronic
1074617046 10:115079877-115079899 TGTGTGTGGTGTGTTTGAGGAGG - Intergenic
1074946142 10:118282635-118282657 TGTGTGCAGTGTGTGTGTGGTGG - Intergenic
1075223140 10:120601671-120601693 CAACTGTGGGCTGTGTGTGGCGG + Intergenic
1075518894 10:123132282-123132304 TATGTGCTTTGTGTGTGTGGTGG + Intergenic
1075594400 10:123717671-123717693 TGTGTGTGGTGTGTGTGTGCAGG - Intronic
1075612666 10:123865990-123866012 TGTGTGTGGTGTGGGGGTGGAGG - Intronic
1075649925 10:124120676-124120698 TGTGTGTGGGGTGTGTGTGTGGG + Intergenic
1075649973 10:124121055-124121077 TGTCTGCGGTGTGTGTATGGGGG + Intergenic
1075649979 10:124121087-124121109 TGTCTGTGGTGTGTGTATGGGGG + Intergenic
1075997722 10:126892137-126892159 TATCTGTGGTGTGTGCATGTGGG - Intergenic
1076481897 10:130790193-130790215 TATGTGTGGGTTGAGTGTGGTGG - Intergenic
1076481977 10:130790815-130790837 TATGTGTGGGTTGAGTGTGGTGG - Intergenic
1076481992 10:130790957-130790979 TGTGTGTGGGGAGTGTGTGGTGG - Intergenic
1076481999 10:130791006-130791028 TGTATGTGGTGTGTGTGTGTGGG - Intergenic
1076482033 10:130791255-130791277 GATGTGTGGTGTGAGTGGGGTGG - Intergenic
1076482090 10:130791603-130791625 TATGTGTGGGGTGTGTGTGGTGG - Intergenic
1076636057 10:131882619-131882641 TATGTGTGGTGTGTGTATGTGGG + Intergenic
1076681448 10:132173721-132173743 TGTGTGTGGTGTGTCTGTGGTGG + Intronic
1076681451 10:132173742-132173764 GGTCTGTGGTGTGTCTCTGGTGG + Intronic
1076681454 10:132173774-132173796 TGTCTGTGATGTGTTAGTGGTGG + Intronic
1076681463 10:132173830-132173852 TGTGTGTGGTGTGTCTGTGGTGG + Intronic
1076681466 10:132173851-132173873 GGTCTGTGGTGTGTCTCTGGTGG + Intronic
1076681469 10:132173883-132173905 TGTCTGTGATGTGTTAGTGGTGG + Intronic
1076681478 10:132173939-132173961 TGTGTGTGGTGTGTCTGTGGTGG + Intronic
1076681481 10:132173960-132173982 GGTCTGTGGTGTGTCTCTGGTGG + Intronic
1076681486 10:132174013-132174035 TGTCTGTGATGTGTTAGTGGTGG + Intronic
1076759415 10:132594052-132594074 GATCTTTGGGGTGTGTGTCGTGG + Intronic
1076859724 10:133135111-133135133 TATCTGTGGTCTGTGTCTCCTGG + Intergenic
1076900968 10:133337214-133337236 TTTGTGAGGTGTGTGTGTGGGGG - Intronic
1076900983 10:133337307-133337329 TGTCTGGGGTGTGTGTGTCTGGG - Intronic
1076903042 10:133349190-133349212 TATGTATGTTGTGTGTGGGGTGG - Intronic
1077004843 11:349543-349565 TGTGTGTGTGGTGTGTGTGGGGG - Intergenic
1077004857 11:349648-349670 TGTGTGGTGTGTGTGTGTGGGGG - Intergenic
1077004859 11:349650-349672 TGTGTGTGGTGTGTGTGTGTGGG - Intergenic
1077004875 11:349805-349827 TTTGTGTGGTGTTTGTGTGGGGG - Intergenic
1077004897 11:349946-349968 TGTGTGTGGTGTTTGTGTGTGGG - Intergenic
1077004907 11:350036-350058 TGTGTGTGGTGTGTGTGTGTGGG - Intergenic
1077004916 11:350109-350131 TGTGTATGGTGTGTGTGTGTGGG - Intergenic
1077033933 11:485378-485400 CATGTGTGCTGTGTGTGTGCAGG + Intronic
1077349346 11:2085167-2085189 CGTGTGTGATGTGTGTGTGGTGG - Intergenic
1077511805 11:2969443-2969465 TTCCTGTGGTGTGAGTGTGCAGG - Intronic
1077552201 11:3205527-3205549 CAGCTGTGCTGTGTGTGTGGTGG - Intergenic
1077598397 11:3554426-3554448 TTTCTCTGTTGTATGTGTGGGGG - Intergenic
1077820481 11:5733439-5733461 TAACTATGGTGTGTGTGTTGGGG - Intronic
1077975238 11:7241250-7241272 GATATGTGCTGTGTGTGGGGGGG - Intronic
1078088926 11:8251757-8251779 TGTGTGTGTGGTGTGTGTGGAGG + Intronic
1078088928 11:8251759-8251781 TGTGTGTGGTGTGTGTGGAGGGG + Intronic
1078088945 11:8251900-8251922 AGTGTGTGGTGGGTGTGTGGTGG + Intronic
1078159576 11:8828946-8828968 TGTGTGTGGGGTGTGTGTGTGGG + Intronic
1078159583 11:8829047-8829069 TGTGTGTGGTGTGTGTGGTGTGG + Intronic
1078930367 11:15907832-15907854 TGTGTGGGGTGTGTGTGTGTAGG - Intergenic
1079016116 11:16870298-16870320 TGTGTGTAGTGTGTGTGTGGGGG - Intronic
1079059865 11:17239167-17239189 TATTTTTTGTGTGTGTGAGGTGG - Intronic
1079211935 11:18469387-18469409 AATCTGTGGTGGGAGTGTGGTGG - Intronic
1079839209 11:25374126-25374148 AATGTGTTGTGTGTGTGTGGGGG - Intergenic
1080158193 11:29138082-29138104 TATCTGTGGTTGGTCTGTAGAGG + Intergenic
1080686841 11:34523072-34523094 TGTCTGTGGGGAGAGTGTGGTGG - Intergenic
1080836411 11:35944457-35944479 TGTGTGTGTTGTGTGTGTTGAGG + Intronic
1081086357 11:38806382-38806404 TTTCAAGGGTGTGTGTGTGGGGG + Intergenic
1081602387 11:44504210-44504232 CGTGTGTGGTGTGTGTGTGTAGG - Intergenic
1081641305 11:44756247-44756269 AGTGTGTTGTGTGTGTGTGGAGG + Intronic
1081670907 11:44942131-44942153 TGTGTGTGATGTATGTGTGGTGG - Intronic
1083163164 11:60867881-60867903 TTTCTGTGGTGAGGGGGTGGGGG - Intronic
1083200202 11:61116518-61116540 GGTGTGGGGTGTGTGTGTGGTGG - Intronic
1083200235 11:61116844-61116866 TGTGTGTGATGTGTGTGTGGTGG - Intronic
1083426966 11:62593158-62593180 TGTGTGTTGTGTGTGTGTTGGGG - Intergenic
1083613149 11:64013986-64014008 GATCTGTGGTGTGGGGGTGGGGG - Intronic
1084005751 11:66322755-66322777 TCTCTGTGGCTTGTGTGTGGTGG + Intergenic
1084188675 11:67488992-67489014 TGTCTGTGGTGGGGGTGAGGAGG + Intronic
1084254476 11:67930302-67930324 TTTCTCTGTTGTATGTGTGGGGG - Intergenic
1084316614 11:68349410-68349432 CATCTTTGCTGTGTGTATGGTGG + Intronic
1084381721 11:68817093-68817115 TGTGTGTGGTGTGTGTGTGTGGG + Intronic
1084381730 11:68817162-68817184 TGTGTGTGGTGTGTGTGTGTGGG + Intronic
1084641736 11:70430342-70430364 TAGCTGTGTGCTGTGTGTGGTGG - Intronic
1085462855 11:76705489-76705511 TGTGTGTTGTGTGTGTGTGTAGG + Intergenic
1085756103 11:79202569-79202591 TCCCTGTGGTGTTTGTTTGGCGG + Intronic
1085816436 11:79742157-79742179 CAACTGTGGGGTGTGGGTGGGGG + Intergenic
1086412637 11:86557889-86557911 TATCTGTGCTGGGTGAGGGGCGG - Intronic
1086818516 11:91404632-91404654 TTACTGTGGGGTGTGTGTGTAGG - Intergenic
1086852906 11:91832141-91832163 GATCTGTGGTGTTTGTGTGTAGG + Intergenic
1086921251 11:92589695-92589717 TATTTATGTTGTGTGTGTGGTGG - Intronic
1087188058 11:95223177-95223199 TTTCTATTGTGTGTGTGTGGTGG - Intronic
1087632822 11:100670620-100670642 CTTCGGGGGTGTGTGTGTGGGGG - Intergenic
1088333063 11:108673215-108673237 TATGTGTGGTGTGTGTGTATTGG + Intronic
1089095385 11:115915964-115915986 GATGTGGGGTGTGTGTGTGTAGG + Intergenic
1089359211 11:117875230-117875252 TATGTGTGGTGTGAGTGTGAGGG + Intronic
1089498339 11:118918954-118918976 TTTCTGTGGTGTGTTCGTGGGGG - Intronic
1089793724 11:120963493-120963515 TCTCTATGGTGTGTGTGTGAAGG - Intronic
1089954354 11:122556339-122556361 CATTTGGGGTGTGTGTTTGGTGG + Intergenic
1090176771 11:124656930-124656952 TCTCTGTGGTGGGTGGGTGGGGG - Intronic
1090602249 11:128385395-128385417 GATCTTTGGTATGTGTGTGAGGG - Intergenic
1091196983 11:133739392-133739414 TGTGGGGGGTGTGTGTGTGGAGG + Intergenic
1091559972 12:1604803-1604825 AGTGTGTGGGGTGTGTGTGGGGG + Intronic
1091559974 12:1604805-1604827 TGTGTGGGGTGTGTGTGGGGGGG + Intronic
1092042019 12:5393558-5393580 TTCCAGTGGTGTGTGTGTTGGGG - Intergenic
1092140827 12:6182388-6182410 CATCTGTGGGGTTTGCGTGGTGG + Intergenic
1092244976 12:6858941-6858963 TATCAGTGGGGTTTGTGTGTTGG - Intronic
1092252975 12:6911496-6911518 TAAGTCGGGTGTGTGTGTGGAGG + Intronic
1092445838 12:8556454-8556476 TATTTTTGGTGTGTCTGTGCGGG + Intergenic
1092688980 12:11086109-11086131 CATGAGGGGTGTGTGTGTGGGGG - Intronic
1093010219 12:14099622-14099644 TATTTCTGGTGTGTCTGTGAGGG - Intergenic
1093081897 12:14821986-14822008 TACTTGTGAGGTGTGTGTGGGGG + Intronic
1093659348 12:21736434-21736456 TATTTTTTGTGTGTGTGTGATGG - Intronic
1094251035 12:28361855-28361877 TATCTGTTTTCTGTGTGTGTGGG + Intronic
1094524560 12:31223025-31223047 TACCTGTGGTGAGTGGGTGCCGG - Intergenic
1095753209 12:45732484-45732506 CATCTATTGTGTGTGTGTGATGG + Intronic
1096013795 12:48247528-48247550 TGTGTGTGTTGTGTGTGTGCAGG - Intergenic
1096503718 12:52080482-52080504 TAACTGTGGGGTGGTTGTGGAGG + Intergenic
1096503843 12:52080924-52080946 TTTGTGTGGTGTGTGTTGGGGGG + Intergenic
1096775699 12:53962346-53962368 TGTAGGTTGTGTGTGTGTGGTGG - Intergenic
1097140220 12:56896463-56896485 TGTATGTGGTGCGTGTGGGGGGG - Intergenic
1097175137 12:57138255-57138277 TATCTGCGGTGGGGGTGGGGAGG - Intronic
1097184983 12:57191777-57191799 TATGTGTGGTGTGTGTATGTGGG - Intronic
1097681535 12:62654350-62654372 TATCTGTTGAGTGTTTCTGGAGG - Intronic
1097946251 12:65371617-65371639 TATACTTTGTGTGTGTGTGGTGG - Intronic
1098220446 12:68264730-68264752 TCTCTGTGGGCGGTGTGTGGAGG - Intergenic
1098476434 12:70909307-70909329 TATCTTTGATGTGTGTGTGGTGG - Intronic
1098998494 12:77149339-77149361 ATTCTCTGGTGTGTGTGTTGAGG - Intergenic
1099047520 12:77740462-77740484 AATGTGTGGTGTTTGTGGGGTGG + Intergenic
1100145504 12:91672719-91672741 TATCTTTGGGGTGGGTATGGGGG + Intergenic
1100549459 12:95633507-95633529 CCTCTGTGATGTGGGTGTGGTGG + Intergenic
1100853895 12:98741234-98741256 TAGCTGGGGTGAGTGGGTGGAGG - Intronic
1100926305 12:99551944-99551966 TTTCAGATGTGTGTGTGTGGTGG - Intronic
1100988494 12:100227653-100227675 TTTTTGTTGTGTGTGTGTGACGG - Intronic
1101095232 12:101332048-101332070 TATCTTTGGGCTGGGTGTGGTGG + Intronic
1101575051 12:105989655-105989677 TATGTGTGTTATGTCTGTGGTGG - Intergenic
1101652471 12:106690058-106690080 TTCCTTTGGTGTGTGTGTTGTGG + Intronic
1102181126 12:110913172-110913194 TGTCAGTTGTGTGTGTGTAGGGG + Intronic
1102681608 12:114694314-114694336 CAGTTGTGGTGTGTGTGTGGGGG - Intergenic
1102775714 12:115516933-115516955 TATGTGTTGTGTGTAGGTGGGGG - Intergenic
1102781435 12:115569249-115569271 CATCTATTGTGTTTGTGTGGTGG + Intergenic
1103606957 12:122094036-122094058 TATCTGTGTGGTGTGTGTGGTGG + Intronic
1103607083 12:122095048-122095070 TGTGTGTGGTGTCTGTGGGGTGG + Intronic
1103797290 12:123513217-123513239 TGTGTGTCGTGTGTGTTTGGGGG + Intronic
1104359548 12:128118940-128118962 AATGTGTGGTTTATGTGTGGTGG + Intergenic
1104362269 12:128145026-128145048 TATCTTTTGTGTGTGTGGTGAGG - Intergenic
1104470378 12:129025209-129025231 TATGTGAGGTGTGGGTGTGTGGG - Intergenic
1104501597 12:129291719-129291741 TGTGTATGGTGTGTGGGTGGAGG + Intronic
1104586895 12:130054792-130054814 TATGTGTGGTGTGTGTGTGGTGG - Intergenic
1104682348 12:130760600-130760622 TATCTTTGGGGTGTCTGGGGAGG - Intergenic
1104820362 12:131673474-131673496 CATCTGTGGTGTCTACGTGGTGG + Intergenic
1104894594 12:132155980-132156002 TGTATGTAGTGTGTGTGTAGTGG - Intergenic
1104894602 12:132156140-132156162 TGTATGTAGTGTGTGTGTAGTGG - Intergenic
1104894610 12:132156311-132156333 TGTATGTAGTGTGTGTGTAGTGG - Intergenic
1104894628 12:132156690-132156712 TGTGTGTAGTGTGTGTGTAGTGG - Intergenic
1104894637 12:132156846-132156868 TGTGTGTAGTGTGTGTGTAGTGG - Intergenic
1104894649 12:132157091-132157113 TGTGTGTAGTGTGTGTGTAGTGG - Intergenic
1104894660 12:132157353-132157375 TGTGTGTAGTGTGTGTGTAGTGG - Intergenic
1104894674 12:132157611-132157633 TGTGTGTAGTGTGTGTGTAGTGG - Intergenic
1104894709 12:132158417-132158439 TGTGTGTAGTGTGTGTGTAGTGG - Intergenic
1104907842 12:132224571-132224593 GTTGTGTGGTGTGTGTGTGTGGG - Intronic
1104907911 12:132224967-132224989 TATATGGGGTGTATGTGTGTGGG - Intronic
1104907990 12:132225430-132225452 GTTGTGTGGTGTGTGTGTGGGGG - Intronic
1104908143 12:132226387-132226409 TATATGAGGTGTATGTGTGTGGG - Intronic
1104976661 12:132555243-132555265 TAGCTGTGGTGTATCTCTGGAGG + Intronic
1105039656 12:132952959-132952981 TGTCTGGGGTGTGTGTGTGATGG - Intronic
1105279468 13:18954863-18954885 TATGTATGGTGTGTGTGATGTGG + Intergenic
1105450773 13:20497330-20497352 TGTGTGTGTAGTGTGTGTGGTGG - Intronic
1105450806 13:20497825-20497847 TGTATGTGGTGTATGTATGGTGG - Intronic
1106364964 13:29069526-29069548 TATTTCTGGTGTGTCTGTGAGGG - Intronic
1106408115 13:29491425-29491447 TGTGTGTGGTGTGTGTGTAGTGG + Intronic
1106408168 13:29491860-29491882 TGTATGTGATGTGTGTGTGGTGG + Intronic
1106433821 13:29706700-29706722 TGTGTGTGGTGTGTGTATTGAGG + Intergenic
1106801685 13:33262647-33262669 TGTGTGTTGTGTGTGTGTGTGGG - Intronic
1108060873 13:46531897-46531919 AATCCTTGGTGTGTGTTTGGGGG - Intergenic
1108149122 13:47512959-47512981 AAGCTGTGGGGAGTGTGTGGTGG + Intergenic
1108592761 13:51925531-51925553 TATTTGTGTTTTGTGTGTAGGGG - Intergenic
1108643405 13:52404231-52404253 TAACTGTGGGCTGGGTGTGGTGG - Intronic
1108704388 13:52972104-52972126 TGTGTGTGGTGTGTGTGTTAGGG + Intergenic
1108947002 13:56039752-56039774 TATATATGGTCTGGGTGTGGTGG + Intergenic
1109193203 13:59350107-59350129 TTTGTGTTGTGTGTGTGTGGTGG + Intergenic
1109204415 13:59465788-59465810 TTTCTCTGCTGTGTTTGTGGGGG + Intergenic
1109335681 13:60990914-60990936 TATCAGAGGTGGGAGTGTGGGGG - Intergenic
1110202388 13:72868010-72868032 CATCTCTGGGCTGTGTGTGGTGG + Intronic
1110231929 13:73176047-73176069 TATCTATGGGCTGGGTGTGGTGG + Intergenic
1111037976 13:82704492-82704514 TGTGTGTGGTTTCTGTGTGGTGG - Intergenic
1112447382 13:99476586-99476608 CACCTTTTGTGTGTGTGTGGGGG - Intergenic
1112538049 13:100280507-100280529 TGTGTGTGGTGTGGGTGTGCAGG - Intronic
1113103664 13:106749395-106749417 TATCATTTGCGTGTGTGTGGCGG - Intergenic
1113263539 13:108592407-108592429 TGTGTGTGGTGTGTGTGTGGAGG + Intergenic
1113327305 13:109294466-109294488 TATGTGTGGTGTGTGTGTACAGG - Intergenic
1113607560 13:111621341-111621363 TGTGTGTGTGGTGTGTGTGGTGG + Intronic
1113615494 13:111677641-111677663 TTTCTGTTGTGTATGTGTGCCGG - Intergenic
1113620962 13:111762543-111762565 TTTCTGTTGTGTATGTGTGCCGG - Intergenic
1113667429 13:112150587-112150609 TGTGTGTGGTGTGTGGGTGTTGG - Intergenic
1113775303 13:112941263-112941285 GGTCTGTGTGGTGTGTGTGGTGG + Intronic
1113786651 13:113005453-113005475 TGACTGTGGTCTGTTTGTGGTGG + Intronic
1113786672 13:113005553-113005575 TGGCTGTGGTCTGTTTGTGGTGG + Intronic
1113865676 13:113521255-113521277 GTTCTGTGGTATGTCTGTGGGGG + Intronic
1113962777 13:114134186-114134208 TATATGTGGTGTGTGTATGTAGG - Intergenic
1113975998 13:114227838-114227860 GATGTGTAGTGTGTCTGTGGGGG + Intergenic
1114191183 14:20440502-20440524 TAGGGGTGGTATGTGTGTGGGGG + Intergenic
1114542403 14:23471376-23471398 TTTCTGTGTTATGTGTGTTGGGG + Intronic
1114693147 14:24604043-24604065 TGTGTGTGTTGTGTGTGTGAAGG - Intergenic
1114835418 14:26197885-26197907 AAACTGTGGTGTGTGTGGTGGGG + Intergenic
1115085012 14:29504894-29504916 TGTGTGTGGTGTGTGTGTGTTGG + Intergenic
1115848223 14:37561634-37561656 TGTGTGTGGTGTGTCTGTTGTGG + Intergenic
1116428244 14:44816274-44816296 TGATTCTGGTGTGTGTGTGGAGG - Intergenic
1117793427 14:59365169-59365191 TGACTGGGGTGTGTGTGTGTAGG + Intronic
1118344773 14:64929944-64929966 CAATTTTGGTGTGTGTGTGGGGG - Intronic
1118375580 14:65174080-65174102 TGTGTGTGCTGAGTGTGTGGGGG + Intergenic
1118536372 14:66770871-66770893 TATCATAGGTGTGTGTGTGTAGG + Intronic
1118685545 14:68286991-68287013 TGTGTGTGTTGTGTGTGTGTTGG + Intronic
1118763910 14:68897580-68897602 AATCTGTGGGTTGTGGGTGGTGG - Intronic
1118947953 14:70406174-70406196 TTCCTGGTGTGTGTGTGTGGTGG - Intronic
1119095537 14:71826875-71826897 TATCTACTGTATGTGTGTGGTGG + Intergenic
1119523031 14:75300212-75300234 TAGAGATGGTGTGTGTGTGGGGG + Intergenic
1119717050 14:76866908-76866930 TGTGTGGGGTGTGTGTGTTGGGG + Intronic
1120032114 14:79653808-79653830 TATATGTGACTTGTGTGTGGGGG - Intronic
1120202338 14:81551248-81551270 CTTCTCTTGTGTGTGTGTGGGGG + Intergenic
1120302442 14:82725269-82725291 TATGTGTGTGGTGTGTGTGGTGG + Intergenic
1120302444 14:82725271-82725293 TGTGTGTGGTGTGTGTGGTGGGG + Intergenic
1120755616 14:88241489-88241511 TGTGTGTGGTGTGGGGGTGGGGG - Intronic
1120911215 14:89668774-89668796 TATGTGTGATGTGTGTGTATGGG - Intergenic
1121569707 14:94937831-94937853 TATCTGTGTGGGGTGTGTGTGGG + Intergenic
1121608404 14:95258400-95258422 GATCTGTGTGGTGTGTGTAGAGG + Intronic
1121608412 14:95258481-95258503 CATCTGTGGTGTGTGTGTTGAGG + Intronic
1121608428 14:95258630-95258652 GGTGTGTGGTGTGTGTGTGGAGG + Intronic
1121608441 14:95258763-95258785 TATCTGTGGTGTGTGTGTGGAGG + Intronic
1121608452 14:95258874-95258896 TATCTGTGGTGTGTGTGTGGAGG + Intronic
1122360231 14:101155155-101155177 TTTCTGTAGGGTGTGTGTAGGGG + Intergenic
1122549027 14:102540008-102540030 TCTCTGGGCTGGGTGTGTGGAGG + Intergenic
1122690103 14:103528227-103528249 CCTCTGTGGAGTGTGTGTGCAGG - Intergenic
1122842262 14:104471918-104471940 TGTGTGTGGTGTGTGTGAGTGGG - Intergenic
1122979913 14:105186764-105186786 TGTGTGGGCTGTGTGTGTGGGGG + Intergenic
1122980012 14:105187123-105187145 TATAGGGGGTGTGTGTGTGGGGG + Intergenic
1123055760 14:105568895-105568917 TGTGTGAGGTGTGGGTGTGGGGG - Intergenic
1123055844 14:105569563-105569585 TATGGGTGGTGGGTGTGTGTAGG - Intergenic
1123080117 14:105688414-105688436 TGTGTGAGGTGTGGGTGTGGGGG - Intergenic
1123080165 14:105688668-105688690 TGTGTGAGGTGTGGGTGTGGGGG - Intergenic
1123080388 14:105690859-105690881 TATGTGTTGTGTGTGTGGTGTGG - Intergenic
1202928728 14_KI270725v1_random:19294-19316 TGTTTGTGGAGAGTGTGTGGTGG + Intergenic
1123724578 15:23089254-23089276 TGTGTGTGTTGTGTGTGTGGTGG - Intergenic
1124168534 15:27351483-27351505 TGTGTATGGTGTGTGTGTGTTGG + Intronic
1124250752 15:28105230-28105252 TGTGTGGGGTATGTGTGTGGGGG + Intergenic
1124344791 15:28914950-28914972 TGCGTGTGGTGTGTGTGAGGTGG - Intronic
1124344799 15:28915003-28915025 TGTGTGTGGTGTGTGTGAGGTGG - Intronic
1124344814 15:28915103-28915125 AGTGTGTGGTGTGTGTGAGGTGG - Intronic
1124354204 15:28983344-28983366 TATTTGTGGTGTGTGTGTGGCGG + Intronic
1124415469 15:29470137-29470159 TGTCTGTGGTATGTGTGTGAAGG - Intronic
1124517078 15:30375675-30375697 TGTGTCTGGTGTGTGTGTGTTGG + Intronic
1124613244 15:31223554-31223576 TAGCCGGGGTGTGTGTGTCGGGG + Intergenic
1124725840 15:32155042-32155064 TGTGTCTGGTGTGTGTGTGTTGG - Intronic
1124802320 15:32845738-32845760 TAGTTCTGGTGTGTGTGTTGGGG - Intronic
1124815163 15:32982853-32982875 TAGCTGTGGTCTGTGTCTAGAGG - Intronic
1124884220 15:33669824-33669846 TATTAGGGGTGTGTGTGTGTGGG + Intronic
1124962310 15:34408164-34408186 TGTGTGTGGTGTGTATGAGGTGG - Intronic
1124978934 15:34554386-34554408 TGTGTGTGGTGTGTATGAGGTGG - Intronic
1125673183 15:41487880-41487902 TGTGTGTAGTGTGTGTGTGGTGG - Intergenic
1126141358 15:45442161-45442183 TATATGTGGGGTCGGTGTGGAGG - Intronic
1127019678 15:54732240-54732262 TATGGGTGGTGTGTGGGTGGGGG + Intergenic
1127224362 15:56914689-56914711 TGTGTGTTGTGTGTGTGGGGAGG + Intronic
1127331727 15:57946600-57946622 TGTGTGTGGGGTGTGTGTGGGGG + Intergenic
1127331748 15:57946721-57946743 TGTTTGTGTTGGGTGTGTGGGGG + Intergenic
1127731353 15:61805278-61805300 TATTTGGGGTGTGTCTGTGAGGG - Intergenic
1128185254 15:65639251-65639273 TCTGTGTGGTGTGTGGGTGAGGG + Intronic
1128809304 15:70559146-70559168 TATGTGTTGTGTGTGTGCTGTGG - Intergenic
1128845998 15:70895429-70895451 TATTTGTGGTGAGAGCGTGGAGG + Intronic
1128875711 15:71199466-71199488 TGTGTGTGGTGTGTGTGTGTGGG + Intronic
1128875724 15:71199566-71199588 TGTGTGTAGTGTGTGTGTGTGGG + Intronic
1129376976 15:75139707-75139729 TATTTTTTGTGTGTGTGTGGTGG - Intergenic
1129455126 15:75672687-75672709 TCTCTGTGTTGTGTGTCTGAAGG + Intergenic
1129878640 15:78993170-78993192 TGTATGTGGTGTGTGTGGTGTGG + Intronic
1129878658 15:78993365-78993387 TGTGTGTAGTGTGTGTGTGTGGG + Intronic
1129894330 15:79092235-79092257 TGTGTGTGGCGTGTGTGTGGTGG - Intergenic
1129934847 15:79439153-79439175 TGTGTGGGGTGTGTGTGGGGTGG + Intronic
1130229601 15:82086692-82086714 TGTGTGTGTTGTGTGTGTGTTGG + Intergenic
1130249422 15:82287811-82287833 TATCAGGTTTGTGTGTGTGGTGG - Intergenic
1130415986 15:83695107-83695129 CATGTGTGGTGTGTGTGTGTGGG + Intronic
1130415988 15:83695109-83695131 TGTGTGGTGTGTGTGTGTGGGGG + Intronic
1131813292 15:96196529-96196551 AATCTCTGGGGTGAGTGTGGTGG - Intergenic
1131981754 15:98001042-98001064 TAGGTGATGTGTGTGTGTGGTGG + Intergenic
1132235028 15:100213474-100213496 TGTGTGTGGTGTGTGTGCTGTGG - Intronic
1132269020 15:100506474-100506496 TGTCTGGTGTGTGTGTGTGTGGG - Intronic
1133256636 16:4521103-4521125 TGTGTGTACTGTGTGTGTGGTGG + Intronic
1133373702 16:5266221-5266243 TTTCTCTGTTGTATGTGTGGGGG + Intergenic
1133394488 16:5435341-5435363 TTTGTGGGGTGTGTGTGTGTTGG + Intergenic
1133427182 16:5702788-5702810 GATCTTTGCTGTGTGTGTTGTGG + Intergenic
1133825352 16:9273394-9273416 TAGCTGTGGGCTGGGTGTGGTGG - Intergenic
1133908196 16:10040686-10040708 TATGTGTGGTGTGAATGTGTAGG - Intronic
1134230883 16:12429272-12429294 TTTCAGTTGTGTCTGTGTGGTGG - Intronic
1134287582 16:12875674-12875696 TGCTTGGGGTGTGTGTGTGGGGG - Intergenic
1135594143 16:23728554-23728576 TATCTATGGTATCTGTATGGTGG + Intergenic
1135780456 16:25295322-25295344 TATCTCTGGGCTGGGTGTGGTGG + Intergenic
1135845400 16:25913973-25913995 TGTATGTGGTGTGTGTGTGCAGG + Intronic
1136114973 16:28088872-28088894 GGTGTGTGGTGTGTGTGTGCGGG - Intergenic
1136114976 16:28088893-28088915 TGTGTGTGGGGTGTGTGTGGGGG - Intergenic
1136115006 16:28089004-28089026 TGTGTGTGGGGTGTGTGTGGGGG - Intergenic
1136115039 16:28089112-28089134 TGTGTGTGGGGTGTGTGTGGGGG - Intergenic
1136115044 16:28089125-28089147 GTTGTGTGGTGTGTGTGTGTGGG - Intergenic
1136115049 16:28089165-28089187 GGTGTGTGGTGTGTATGTGGGGG - Intergenic
1136115099 16:28089413-28089435 TGTGTGTGGTGTATGTGTGTGGG - Intergenic
1136115116 16:28089524-28089546 TGTGTGTGGTGTGTATGTGTGGG - Intergenic
1136115138 16:28089681-28089703 TGTGTGTGGTGTGTGTGTGCGGG - Intergenic
1136405672 16:30045269-30045291 TGTGTGTGGTGTGTGTGTGGTGG + Intronic
1136653490 16:31693838-31693860 TGTGTGGGGGGTGTGTGTGGGGG - Intergenic
1136653502 16:31693880-31693902 TATGTGTGTGGTGTGTGTGTGGG - Intergenic
1137273043 16:46915511-46915533 TGTCTGTGTGGTGTGTGTGTAGG - Intronic
1137296982 16:47104137-47104159 TAACGGGGGTGTGGGTGTGGGGG - Intronic
1137365328 16:47854892-47854914 TGTGTGTGGTGTGTGTATGTTGG - Intergenic
1137365342 16:47855035-47855057 TGTGTGTTGTGTGTGTGTGCTGG - Intergenic
1137501675 16:49016405-49016427 TGTGTGATGTGTGTGTGTGGTGG + Intergenic
1137532312 16:49286841-49286863 TATCTGTGTGCTGTTTGTGGTGG + Intergenic
1137731304 16:50692778-50692800 TGTGTGGGGTGTGTGTGTGTTGG + Intergenic
1138140167 16:54561155-54561177 TGTGTGTGGTGTAAGTGTGGAGG - Intergenic
1138191913 16:55020458-55020480 TTTTTTTGGGGTGTGTGTGGGGG + Intergenic
1138529336 16:57626704-57626726 TCTGTGGGGTGTGTGTGTGGTGG + Intronic
1138773936 16:59697492-59697514 TTTCTTTCTTGTGTGTGTGGGGG - Intergenic
1138844031 16:60543299-60543321 TTTAAGTGGTGTTTGTGTGGAGG + Intergenic
1139706021 16:68741185-68741207 AATCTGTTGTGTGGGGGTGGGGG - Intronic
1140022241 16:71249504-71249526 TGTGTTTGGTATGTGTGTGGGGG - Intergenic
1140130220 16:72153965-72153987 AATATGTGGAGTGTGTGTGCAGG - Intronic
1140136246 16:72208147-72208169 TATCTTGGGTGTGTGTATGAGGG - Intergenic
1140438285 16:74966614-74966636 TGTCTTGGGTGTGTGTGGGGTGG - Intronic
1140709999 16:77668797-77668819 TATCTGTGGTCAGTCTCTGGAGG - Intergenic
1140776728 16:78255619-78255641 TAAGTGGGGTGTGTGTGTGAAGG - Intronic
1140927470 16:79598603-79598625 TGTGTGTGGTGTGTGCGTGCGGG + Intronic
1140961086 16:79913839-79913861 TGTGTGTGGTGTGTGTTTGTGGG - Intergenic
1141236273 16:82220397-82220419 TGTGTGTGGTGTGTGTGATGTGG + Intergenic
1141256004 16:82403121-82403143 TGTCTGTGGTGGGTGTTTTGGGG + Intergenic
1141712236 16:85706568-85706590 TATGTGTGGTGTGTGTGTGTGGG - Intronic
1142298693 16:89243700-89243722 CACCTGTTGTGTGTGTGTGGTGG + Intergenic
1142673637 17:1499737-1499759 GAGGTGGGGTGTGTGTGTGGCGG + Intronic
1143241026 17:5443363-5443385 TATCAGTGTTTTGTGTGTGTAGG - Exonic
1143470951 17:7174851-7174873 TATGTGTGTTGTGTGTGTTGTGG - Intronic
1144461916 17:15465392-15465414 TGTGTGTTGTGTGTGTGTGTTGG - Intronic
1144476278 17:15591807-15591829 AGTGTGTGGTGTCTGTGTGGAGG - Intronic
1144648435 17:16991061-16991083 TGTGTGGGGTGTGTGTTTGGGGG - Intergenic
1144648452 17:16991128-16991150 TGTGTGGGGTGTGTGTTTGGGGG - Intergenic
1144893386 17:18509050-18509072 TATGTGGTGTGTGTGTGTGTAGG - Intergenic
1145138840 17:20435224-20435246 TATGTGGTGTGTGTGTGTGTAGG + Intergenic
1145889819 17:28406396-28406418 TATCTGTGGTGTGTCTGGGCCGG - Intronic
1146154113 17:30505705-30505727 TAAATGTTGTGTATGTGTGGGGG + Intronic
1146274623 17:31508854-31508876 TATCAGCAGTGTGTGTGTTGGGG + Intronic
1146279512 17:31536148-31536170 TCTGTGTCCTGTGTGTGTGGTGG + Exonic
1146693977 17:34895237-34895259 TATGTGTTGTGTGTGTGAGTGGG - Intergenic
1147383323 17:40068435-40068457 TATCTGGGGCTGGTGTGTGGTGG + Intronic
1147490844 17:40864614-40864636 TGTGTGTGATGTGTGTGTGTTGG - Intronic
1147590940 17:41682924-41682946 TGTGTGTTGTGTGTGTATGGCGG - Intergenic
1147714967 17:42499946-42499968 TAGCTGTGGACTGGGTGTGGGGG + Intronic
1148222148 17:45870492-45870514 TTTGTGGGGTGTGTGTGTGTGGG + Intergenic
1148614939 17:48995183-48995205 GGTCGGAGGTGTGTGTGTGGGGG + Intergenic
1148739056 17:49881559-49881581 TCTCTGGGGAGTGTGTGTTGTGG - Intergenic
1148789801 17:50166816-50166838 TGTGTGGGGTGTGTGTGTGACGG - Intronic
1148854033 17:50569007-50569029 TGTGTGTGTTGTGTGTGTTGGGG + Intronic
1149458630 17:56809764-56809786 TGTATGAGGTGTGTGTGTAGAGG - Intronic
1149458663 17:56809988-56810010 TGTCTGGGGTGTGTGTGTGAAGG - Intronic
1149627465 17:58089883-58089905 TGTCTGTGGTGTGTGGGAGTGGG + Exonic
1149951264 17:60989666-60989688 TATCAGTTATGTGTGTGTGTTGG + Intronic
1150580252 17:66467051-66467073 TCTCTGTCGTGTGTGTTTGCAGG - Intronic
1150653798 17:67026708-67026730 TGTCTGAGGAGTGTGTGTTGAGG + Intronic
1151162425 17:72176592-72176614 TTTCTTTTGTGTGTGTGTTGGGG + Intergenic
1151512308 17:74568454-74568476 TATGTGTAGTGTGTGTGGTGTGG + Intergenic
1151512390 17:74569232-74569254 TATGTGTGTGGTGTGTGGGGTGG + Intergenic
1152160835 17:78667561-78667583 TGTGGGGGGTGTGTGTGTGGGGG + Intergenic
1152294766 17:79460389-79460411 TGACTGTGGTGGGAGTGTGGTGG - Intronic
1152318008 17:79591909-79591931 CATGTGTGGAGGGTGTGTGGAGG + Intergenic
1152394641 17:80025153-80025175 TGTCTATGGTGTGTGTGTCCTGG - Intronic
1152435728 17:80274819-80274841 TGTCTGTGGGGGGTGAGTGGGGG + Intronic
1152435788 17:80275127-80275149 TGTGAGTGGTGTGTGTGTGTTGG + Intronic
1152436784 17:80281215-80281237 TGTGAGTGGGGTGTGTGTGGGGG - Intronic
1152436809 17:80281335-80281357 TGAGTGGGGTGTGTGTGTGGGGG - Intronic
1152695601 17:81742224-81742246 TGTTTGTGGTGTGTATGTGGGGG - Intergenic
1152695611 17:81742331-81742353 TGTGGGGGGTGTGTGTGTGGGGG - Intergenic
1152695616 17:81742346-81742368 TGTGTGTGGTGTGTTTGTGGGGG - Intergenic
1152695649 17:81792676-81792698 TGTGTGTGGTGTATTTGTGGGGG - Intergenic
1152695703 17:81793187-81793209 TGTGTGGGGTGTGTGTGTGGGGG - Intergenic
1152695705 17:81793189-81793211 TGTGTGTGGGGTGTGTGTGTGGG - Intergenic
1153277316 18:3380234-3380256 TTTCTTTTGTGTGTGTGTGGTGG - Intergenic
1153536811 18:6110548-6110570 TATGTGTGGTGTGTGTATGTGGG + Intronic
1153591198 18:6675657-6675679 TATATGTGGTGTGTGGATGTGGG + Intergenic
1153829676 18:8911159-8911181 CATGTGTAGTGTATGTGTGGAGG - Intergenic
1153986372 18:10354476-10354498 TAGCTGTGGGGTATGGGTGGAGG - Intergenic
1154004208 18:10512979-10513001 TGTGTGTGGTGTGTGTGGGTGGG + Intergenic
1154095365 18:11409847-11409869 TTCCTCTTGTGTGTGTGTGGGGG + Intergenic
1154229781 18:12544980-12545002 TTTTGGTGGTGTGTGTGTTGGGG - Intronic
1154268901 18:12902259-12902281 TATTTCTGGTGTGTCTGTGAGGG + Intronic
1155814216 18:30284161-30284183 TATCTCTGGTATGTCTGTGAGGG - Intergenic
1156055398 18:32997151-32997173 TATTTGTACTCTGTGTGTGGGGG + Intronic
1156441409 18:37192184-37192206 TATGTGTGTTGCGTGTGTGGAGG + Intronic
1157700953 18:49761388-49761410 TGTGTGTGGGGTGTGTTTGGGGG - Intergenic
1158560908 18:58512865-58512887 TGTATGTGTGGTGTGTGTGGGGG + Intronic
1158704837 18:59783032-59783054 TTTCTGTTATGTGTGTGTGATGG - Intergenic
1158889877 18:61862844-61862866 TATCATTGGTGTGTGGGTAGGGG + Intronic
1158984926 18:62804346-62804368 TATCGGGGGTGTATGTGTAGGGG + Intronic
1159014770 18:63092417-63092439 TGTGTGTGGTGTGTGTGGTGTGG + Intergenic
1159016211 18:63103582-63103604 TCTGTGTGTTGTGTGTGTGTGGG + Intergenic
1159016213 18:63103584-63103606 TGTGTGTTGTGTGTGTGTGGGGG + Intergenic
1159614428 18:70564289-70564311 TATCTTGTGTGTTTGTGTGGAGG + Intergenic
1159688925 18:71460706-71460728 TTTATGGGGTGTGTGTGTGGAGG + Intergenic
1160240397 18:77118589-77118611 TGTCTGTGGAGTGTGTGTGTGGG - Intronic
1160404935 18:78638932-78638954 TGTGTGTGGTGTGTGTGGTGTGG - Intergenic
1160415024 18:78703755-78703777 TGTGTGTGGTGTGTGTGTGTTGG + Intergenic
1160415029 18:78703781-78703803 TGTGTGCGGTGTGTGTGTTGGGG + Intergenic
1160415057 18:78703986-78704008 TGTGTGTAGTGTGTGTGTTGGGG + Intergenic
1160415063 18:78704030-78704052 TGTCTATAGTGTGTGTGTTGGGG + Intergenic
1160429125 18:78799510-78799532 TGTGTGCGTTGTGTGTGTGGTGG - Intergenic
1160523505 18:79522320-79522342 TGTGTGTGTTTTGTGTGTGGTGG + Intronic
1160867746 19:1263165-1263187 TATATGGGGTGTGTCTGGGGGGG - Intronic
1161477132 19:4492723-4492745 TGTGTGTGGTGTATGTGTGTTGG + Intronic
1161477142 19:4492858-4492880 TGTGTGTGGTGTGTGTGGTGTGG + Intronic
1161905442 19:7153050-7153072 TGTGTGGTGTGTGTGTGTGGGGG - Intronic
1161905444 19:7153052-7153074 TGTGTGTGGTGTGTGTGTGTGGG - Intronic
1161921427 19:7269067-7269089 GGACTGTGGTGTGTGTGTTGGGG - Intronic
1162373717 19:10293235-10293257 TAACGGTGGAGTGTGAGTGGGGG + Exonic
1162375769 19:10304577-10304599 TATCTGTTGTGTGTGTCTGTGGG + Intergenic
1162569745 19:11464687-11464709 TGTGTGTGGTGTATGTGTGTGGG - Intronic
1162829134 19:13273311-13273333 CATTTTTTGTGTGTGTGTGGGGG + Intronic
1163540747 19:17908521-17908543 TTTGTTTTGTGTGTGTGTGGAGG + Intergenic
1163629731 19:18411990-18412012 TATTTTGTGTGTGTGTGTGGGGG - Intergenic
1163637204 19:18442614-18442636 TGTGTGTGGTGTGTGGGTGTTGG - Intergenic
1163672257 19:18636326-18636348 GATCAGGGGTGTGTGCGTGGAGG - Intergenic
1163968887 19:20773507-20773529 CATTTGATGTGTGTGTGTGGGGG + Intronic
1164438687 19:28254719-28254741 TATTTTTGGTGTGTCTGTGGGGG - Intergenic
1164825925 19:31284787-31284809 TAACTGGGGTGTGGGTGTGTGGG - Intronic
1164828901 19:31305189-31305211 GATTTGTGGTGTGTGTGTGGAGG - Intronic
1165082353 19:33315723-33315745 TATCTCTGGGCTGGGTGTGGTGG + Intergenic
1165104067 19:33458471-33458493 TATGTGGGGGTTGTGTGTGGAGG + Intronic
1165648282 19:37464139-37464161 TATTTTGTGTGTGTGTGTGGTGG - Intronic
1166089188 19:40497313-40497335 TAGCTGTGATGTGAGTGTGATGG - Intronic
1166140725 19:40803816-40803838 TGACTGGGGTGTGTGTGTAGTGG + Intronic
1166159896 19:40944641-40944663 TTTTTGTGCTGTGTGTGTGGAGG + Intergenic
1166214865 19:41328196-41328218 TCTGTGTGGGGTGTGTCTGGTGG + Intronic
1166302339 19:41918361-41918383 TATGTGTGGTGTGTGTGGTATGG - Intronic
1166302365 19:41918665-41918687 TGTGTGTGGTGTGTCTGTGATGG - Intronic
1166344147 19:42154995-42155017 TGTGTGTGGACTGTGTGTGGAGG - Intronic
1166445691 19:42855961-42855983 TCTCTTCTGTGTGTGTGTGGGGG - Intronic
1166752862 19:45172990-45173012 TATCTGAGGAGGGTGTGGGGCGG - Intronic
1166962296 19:46505223-46505245 TATTTGTGCTGTGTGTATGTGGG - Intronic
1167033450 19:46978738-46978760 TGTGTGGTGTGTGTGTGTGGTGG + Intronic
1167116138 19:47490068-47490090 TGTGTGTGGTGTGTGTGTTGGGG + Intronic
1167116173 19:47490377-47490399 TGTGTGTGGGGTGTGTGGGGTGG + Intronic
1167116181 19:47490467-47490489 TATGTTTGGTGTGTGTGGTGTGG + Intronic
1167116186 19:47490520-47490542 TATGTTTGGTGTGTGTGGTGTGG + Intronic
1167116359 19:47491363-47491385 TCTGTGGGGTGTGTGTGTGTGGG + Intronic
1167382021 19:49143762-49143784 GCTCTGTTGTGTGTGTGGGGTGG + Intronic
1167514488 19:49915140-49915162 GATGTGTGCTATGTGTGTGGGGG + Intronic
1167677638 19:50897426-50897448 TGTGTGTTGTGTGTGTGTGGTGG - Intergenic
1168305789 19:55434428-55434450 TGTGTGTGGTGTGTGTGTGTGGG + Intronic
1168305877 19:55435379-55435401 TATATGTGGTGTGTGTGTGTGGG + Intronic
1168453964 19:56490400-56490422 CATCTTTGGTGTGTGTGTACTGG - Intergenic
1168517695 19:57022138-57022160 ATTCTTTGTTGTGTGTGTGGTGG - Intergenic
925025662 2:605200-605222 TGTGTGTAGTGTGTCTGTGGTGG - Intergenic
925104675 2:1281238-1281260 GGTGTGTGGTGTGTGTGTGGTGG + Intronic
925104682 2:1281319-1281341 TGTGTGGTGTGTGTGTGTGGTGG + Intronic
925104691 2:1281423-1281445 GTGGTGTGGTGTGTGTGTGGTGG + Intronic
925140698 2:1548055-1548077 TATGTGGTGTGTGTGTATGGTGG - Intergenic
925140707 2:1548130-1548152 TGTCTGTGTGGTGTGTGTGCAGG - Intergenic
925148281 2:1596770-1596792 CATCTGTGGTGTGTGTGTTTGGG - Intergenic
925149388 2:1604664-1604686 TCTGTGTGTTGTGTGTGTGTAGG - Intergenic
925156821 2:1655015-1655037 GGTGTGTGGTGTGTGTGAGGAGG - Intronic
925291291 2:2750178-2750200 TGTGTGTGGTCTGTGTGGGGTGG + Intergenic
925291297 2:2750222-2750244 TGAGTGTGGTGTGTGTGGGGTGG + Intergenic
925291303 2:2750308-2750330 TATGTGTGGTGTGTGTGACGTGG + Intergenic
925291346 2:2750565-2750587 TGTGTTTGGTGTGTGTGGGGTGG + Intergenic
925291356 2:2750626-2750648 TATGTGTGTTGTGTGTGGAGTGG + Intergenic
925395071 2:3527556-3527578 TGTGTGTGGTGTGTGTATGGTGG + Intergenic
925395103 2:3527906-3527928 TGTGTGTGGTGTGTGTGCTGTGG + Intergenic
925541610 2:4973608-4973630 GGTGTGTGATGTGTGTGTGGTGG + Intergenic
925914755 2:8596721-8596743 TATGTATGGTGTGTGTGGTGTGG + Intergenic
925914822 2:8597341-8597363 TATATGTGGTGTGTATGTGTGGG + Intergenic
925976274 2:9144237-9144259 TGTGTGTGGTGTGTGTGTGGGGG - Intergenic
926369071 2:12162298-12162320 TCTTTGTGTTGTGTGTGGGGGGG - Intergenic
926404487 2:12537079-12537101 TGCTGGTGGTGTGTGTGTGGGGG + Intergenic
926450848 2:13001986-13002008 TGTATGTGCTGTGTGTTTGGAGG + Intergenic
926591672 2:14746175-14746197 TATGTGTGTGGCGTGTGTGGAGG - Intergenic
926790908 2:16570772-16570794 CATTGTTGGTGTGTGTGTGGTGG - Intronic
927145820 2:20165213-20165235 TGAATGTGGTGTGTGTGTGGTGG - Intergenic
927245453 2:20953941-20953963 TGTGTGTGGGGTGTGTGTGTGGG + Intergenic
927245455 2:20953943-20953965 TGTGTGGGGTGTGTGTGTGGGGG + Intergenic
927245475 2:20954125-20954147 TATGTGTGTGGTGTGTGTGTGGG + Intergenic
927245477 2:20954127-20954149 TGTGTGTGGTGTGTGTGTGGGGG + Intergenic
927388674 2:22567610-22567632 TGTGTGTGGTATGTGTGTGTAGG - Intergenic
927395823 2:22650146-22650168 TGTCTGTGGTGCGGGTGTGTGGG - Intergenic
928005913 2:27561452-27561474 TATCTCTTTTGTGTGTGTGGCGG + Intronic
928140444 2:28723990-28724012 GATCTGTGGTTTGGGGGTGGGGG - Intergenic
928161387 2:28928960-28928982 CAACTGTGGTCTGGGTGTGGTGG - Intronic
928171326 2:29005920-29005942 TGTGTGTGGAGTGTGTGTGTGGG + Intronic
928195977 2:29216777-29216799 TGTGTGTGGTGTGTATGTGTGGG + Intronic
928196003 2:29217017-29217039 TGTATGTGGTATGTGTCTGGGGG + Intronic
928196010 2:29217094-29217116 TCTATGTGGTGTGTCTGTGGGGG + Intronic
928404644 2:31005256-31005278 CTTCTGTGTTGTGTGTGTGGGGG + Intronic
929573808 2:43039858-43039880 TTGCTGTGGTGTGTGTGGGAGGG - Intergenic
929587241 2:43124274-43124296 CATGTGTGGTGAGTGTGTGAGGG - Intergenic
929959793 2:46487873-46487895 TATCTGTAGGGTGTCTGAGGTGG + Intergenic
929966609 2:46542000-46542022 TCTGGCTGGTGTGTGTGTGGAGG + Intronic
930003461 2:46877698-46877720 TGTGTGTGGTGTGGGTGTGTGGG - Intergenic
930003478 2:46877811-46877833 TGTGTGTGGTGTGTGTGTATGGG - Intergenic
930226976 2:48804096-48804118 TTACAGTGCTGTGTGTGTGGTGG + Intergenic
930309224 2:49716512-49716534 TAGCTGTGGTCTGGTTGTGGAGG + Intergenic
931133522 2:59368725-59368747 CATCTGGGGTGTCTGTTTGGTGG - Intergenic
931175398 2:59849417-59849439 TATTTGGGGTGTGTGTGTGGAGG - Intergenic
931618957 2:64190592-64190614 TGTTTGTGGTGTCTGTGTGTGGG - Intergenic
931674395 2:64679551-64679573 TTACTGTGGTGTGGGTGTTGGGG + Intronic
931809507 2:65841222-65841244 AATCTTTGGGGTGTGTGTGTGGG - Intergenic
931937341 2:67213907-67213929 TATGTGGGGTGTGTGTATGTGGG - Intergenic
931978829 2:67672301-67672323 TATGTGCTGTGTGTGTGTTGTGG - Intergenic
932030774 2:68182085-68182107 TACTGGTCGTGTGTGTGTGGTGG - Intronic
932300690 2:70665004-70665026 CCTGTGTGGTGTGTGTGTGATGG + Intronic
933445079 2:82369417-82369439 TATCTGTGGTGTGGTTTTGCGGG + Intergenic
933455293 2:82511941-82511963 TGTCTGTTGGGTGGGTGTGGTGG - Intergenic
933514937 2:83288795-83288817 GATCTTTTGTGTGTGTGGGGGGG - Intergenic
933608274 2:84407060-84407082 TGTCTGTTGTGTGTGTGTTGGGG - Intergenic
934078284 2:88446606-88446628 TAGCTTTTGTGTGTGTGTGTGGG - Intergenic
934663160 2:96153846-96153868 AATGTGTGGTGTGTGTGTTCTGG - Intergenic
935126290 2:100226210-100226232 AAGCTGGGGTGTGTGTGTGCAGG - Intergenic
935418932 2:102846458-102846480 CATCTGGGGTGTGAGTGTGAAGG + Intergenic
935512237 2:103990561-103990583 TGTGTGTGTTGTGTATGTGGGGG + Intergenic
935843009 2:107133889-107133911 TTTGTGTGGTGTGTGTGGGGGGG + Intergenic
935850503 2:107213853-107213875 GGTATGTGGTGTGTGTGTGTTGG - Intergenic
936417508 2:112330628-112330650 TATGTGTGTTGTATGTGTGGTGG - Intronic
936580836 2:113699126-113699148 TATTTCTGGTGTGTTTGTGAGGG - Intergenic
936758809 2:115748376-115748398 TATTTGTGGTTTAGGTGTGGTGG - Intronic
937082493 2:119150301-119150323 TGTGTGTGGTGTGTGTGGGGTGG - Intergenic
937248955 2:120511391-120511413 TCTTTGAGGTGTGTGTGTTGGGG - Intergenic
937335659 2:121060790-121060812 TGTCTGAGGTGTGTGGATGGAGG + Intergenic
937390111 2:121478662-121478684 TGTGTGTGTGGTGTGTGTGGGGG - Intronic
937390131 2:121478770-121478792 TGTGTGTGGGGTGTGTGTGTGGG - Intronic
937390150 2:121478900-121478922 TGTGTGTGGTGTGTGTGGTGTGG - Intronic
937390155 2:121478936-121478958 TGTGTGTGGTGTGTGTGTGGGGG - Intronic
937494904 2:122408240-122408262 TGTGTGTGGTGCATGTGTGGTGG + Intergenic
937655627 2:124371960-124371982 TATATCTGGTGTGTCTGTGAGGG + Intronic
937694558 2:124793794-124793816 TATTAATGGTGTGTGTGTAGGGG - Intronic
937767905 2:125683073-125683095 TGTGTGTGGTGTGTGTGTGCAGG - Intergenic
937825593 2:126365416-126365438 TGTGTGGGGTGTGTGTGTGGTGG + Intergenic
938097132 2:128471355-128471377 TCACTGTGGTGTGTGGGAGGAGG + Intergenic
938097139 2:128471389-128471411 TCACTGTGGTGTGTGGGAGGAGG + Intergenic
938097217 2:128471683-128471705 TCACTGTGGTGTGTGGGAGGAGG + Intergenic
938220065 2:129558523-129558545 TATCTGTTGTGCGTGTGTCTTGG + Intergenic
938633757 2:133199074-133199096 TATCTATGATGTGTGTTTAGGGG - Intronic
940357624 2:152762997-152763019 AATCTTTCTTGTGTGTGTGGTGG - Intergenic
940853366 2:158708971-158708993 TATATGTGGGCTGGGTGTGGTGG - Intergenic
940862859 2:158788139-158788161 TATAGGTGGGGTGTGTGTGGTGG - Intergenic
941304427 2:163844843-163844865 TATGTGTAGTGTGTGTGTTTGGG + Intergenic
941322935 2:164077849-164077871 TTTTTGTGTTTTGTGTGTGGTGG - Intergenic
941327881 2:164140459-164140481 CTTCTGAAGTGTGTGTGTGGGGG + Intergenic
941641550 2:167994419-167994441 TGTTTTTTGTGTGTGTGTGGAGG + Intronic
941947288 2:171113558-171113580 TATATGTGGGCTGGGTGTGGTGG - Intronic
942332254 2:174838862-174838884 AAAATGTGGTGTGTGTTTGGTGG + Intronic
942546684 2:177072123-177072145 TGGCGGGGGTGTGTGTGTGGGGG + Intergenic
943118037 2:183697982-183698004 TATTTTGTGTGTGTGTGTGGTGG - Intergenic
943618720 2:190123098-190123120 TATATTTAGTGTGTGTGTGGGGG - Intronic
944303307 2:198150048-198150070 TATGTGTGGTGGTTGTGAGGTGG - Intronic
945726244 2:213474889-213474911 AATCTGGGGTGTGTCTGTGAGGG - Intronic
945868912 2:215205777-215205799 TACCTTTTGTGTGTGTGTGTTGG - Intergenic
945957404 2:216099158-216099180 TGTATGTGGTATGTGTGGGGAGG + Intronic
945964137 2:216167546-216167568 TCTCTCTCGTGTGTGTGTGTGGG + Intronic
946029588 2:216693874-216693896 TGTTTGTGGTGTGTGTGTAGGGG + Intronic
946104720 2:217359032-217359054 TGTGGGTGGTGTGTGTGAGGGGG - Intronic
946150540 2:217764354-217764376 ATTCCATGGTGTGTGTGTGGTGG + Intergenic
946155750 2:217805562-217805584 TGTGTGTGTGGTGTGTGTGGTGG - Intronic
946383175 2:219363022-219363044 TATGTGGGGTGTGTGTTTGTGGG + Intergenic
946954919 2:224919062-224919084 TATGTGTGGTGTGTGTGTGTGGG + Intronic
946958375 2:224957059-224957081 CATTTGTTGTTTGTGTGTGGGGG + Intronic
946976620 2:225160047-225160069 TATTTTGTGTGTGTGTGTGGAGG - Intergenic
947137291 2:226987852-226987874 AATCTGTGGTGAGGGGGTGGAGG + Intronic
947157933 2:227182281-227182303 TAGCTGTCGTGAGTGGGTGGAGG - Intronic
947311468 2:228808496-228808518 GATTTGTGGTGGGGGTGTGGGGG + Intergenic
947394260 2:229671938-229671960 GATCTCTGGTTTGTGTGAGGAGG + Intronic
947662908 2:231883163-231883185 TTGCTATTGTGTGTGTGTGGGGG + Intergenic
947757715 2:232580070-232580092 TGTGTGTGGTATGTATGTGGGGG - Intronic
947849962 2:233278595-233278617 TTTCTGTGGTGAGGGAGTGGTGG + Intronic
947994315 2:234514292-234514314 TATGTGTGTGGTGTGTGGGGGGG + Intergenic
947994361 2:234514797-234514819 TATGTGTGGTGTGTGTGGTGTGG + Intergenic
948123162 2:235545832-235545854 TATCGGAGGTGTGTGGATGGTGG - Intronic
948192615 2:236071541-236071563 TATGTGTGCTGTGTGTGCAGAGG + Intronic
948304742 2:236938274-236938296 TGTGTGTGGTGTGGGTGTGGTGG + Intergenic
948306895 2:236954958-236954980 CATTCCTGGTGTGTGTGTGGAGG - Intergenic
948367207 2:237464698-237464720 TGTGTGTGGTGTGTGTGTGTGGG + Intergenic
948428191 2:237901852-237901874 TTTCTGTAGTGAGTATGTGGGGG - Intronic
948563637 2:238870121-238870143 GGGGTGTGGTGTGTGTGTGGGGG - Intronic
948563736 2:238870633-238870655 GGTGTGTGCTGTGTGTGTGGGGG - Intronic
948563857 2:238871219-238871241 GGTGTGTGCTGTGTGTGTGGGGG - Intronic
948563903 2:238871475-238871497 TGTGTGTGGTGTGTGTGGGAGGG - Intronic
948569426 2:238908238-238908260 TGTATGTGGTGTGTGTTTGGGGG - Intronic
948682174 2:239642501-239642523 TGTGTGTGGTGTGTATGTGTGGG + Intergenic
948682218 2:239643067-239643089 TGTGTGTGGTGTGTATGTGTGGG + Intergenic
948716554 2:239869268-239869290 TGTCTGTGGTGTGTGTGAGGAGG - Intergenic
948753807 2:240147144-240147166 TCTGTGTATTGTGTGTGTGGGGG + Intergenic
948864512 2:240768486-240768508 TCTTTGGGGTGGGTGTGTGGGGG + Intronic
948985204 2:241517545-241517567 TATGTGTATTGTGTGTGTTGAGG - Intergenic
948985207 2:241517590-241517612 TGTGTGTTGTGTGTGTGTTGAGG - Intergenic
948989538 2:241546101-241546123 TACGTGTGGTGTGTATGTGGGGG - Intergenic
948989555 2:241546465-241546487 TACGTGTGGTGTGCGTGTGTAGG - Intergenic
1169757824 20:9062337-9062359 TACCTGTGGTGTGGTGGTGGTGG + Intergenic
1169989313 20:11483143-11483165 AATCTGTGCTGTGTGTTTAGCGG - Intergenic
1170182082 20:13543236-13543258 AATGTGTGGTGTGGGTGGGGTGG - Intronic
1170849464 20:19991390-19991412 TGTCTTTAGTGTGTGTGTTGAGG - Intronic
1171109994 20:22472038-22472060 TGTATATGGTATGTGTGTGGTGG - Intergenic
1171373097 20:24674271-24674293 TATCTGTGGTGCTTGTGTGGGGG + Intergenic
1171824645 20:29883970-29883992 TTTATGTGGTGTCTGTGTGTGGG - Intergenic
1172330525 20:34073276-34073298 TATTCGACGTGTGTGTGTGGTGG + Intronic
1172581038 20:36048576-36048598 TAACAGTGCTGTGTATGTGGTGG - Intergenic
1172620401 20:36315001-36315023 TGTGTGTGGTGCGTGTGTGGTGG + Intronic
1172742146 20:37177392-37177414 TATCTGTTGTAACTGTGTGGTGG - Intronic
1172904104 20:38356105-38356127 TGTGTGTGGTGTGTGTGTGCTGG - Intronic
1172904132 20:38356274-38356296 TGTGTGTGGTGTGTGTGTAGGGG - Intronic
1172937000 20:38627573-38627595 TGTGTGTGTTGTGTGTGTTGGGG + Intronic
1172937015 20:38627675-38627697 TGTGTGTGTTGTGTGTGTGTTGG + Intronic
1173024772 20:39297823-39297845 TATGTGTGTTGTGTGTCTGAAGG + Intergenic
1173261904 20:41443917-41443939 TGTCTATGGTGGGTGTGTTGGGG + Intronic
1173364755 20:42375136-42375158 TAATTGGGGTGTGTGTGTCGGGG + Intronic
1173610683 20:44365091-44365113 TATTTAACGTGTGTGTGTGGAGG - Intronic
1174136822 20:48385530-48385552 TGTGTGTGGGGTGTGTGTGTGGG + Intergenic
1174136824 20:48385532-48385554 TGTGTGGGGTGTGTGTGTGGGGG + Intergenic
1174136843 20:48385649-48385671 TGTGTGTGGTGTGTGTGTGGGGG + Intergenic
1174136848 20:48385685-48385707 TATGTGTGTGGTGTGTGTGGGGG + Intergenic
1174338969 20:49884186-49884208 TGTGTGTGTCGTGTGTGTGGAGG - Intronic
1174663223 20:52233823-52233845 TCTCTGGGGTGTGTGGGTTGTGG + Intergenic
1175073961 20:56358673-56358695 TAACTGTGGTGTGTAGTTGGCGG - Intergenic
1175127006 20:56759941-56759963 TTTCAGTGGGGTGTGTGTGATGG + Intergenic
1175527068 20:59642411-59642433 TATCTCTGGGGTGGGGGTGGGGG - Intronic
1175639034 20:60611304-60611326 TCTCAGTAGTGTGTGTGTTGGGG - Intergenic
1176242771 20:64082799-64082821 TGTGTGGGGTGTGTGTGTGTGGG + Intronic
1176256049 20:64153811-64153833 CATGTGTGGGGTGTGTGTGTGGG + Intronic
1176590750 21:8647881-8647903 TGTTTGTGGAGAGTGTGTGGTGG + Intergenic
1177040013 21:16096410-16096432 TATTTCTGGTGTGTCTGTGAGGG - Intergenic
1177623480 21:23627655-23627677 TATCTGTTGACTGGGTGTGGTGG + Intergenic
1177721378 21:24910934-24910956 TATCCTATGTGTGTGTGTGGTGG - Intergenic
1178505489 21:33159315-33159337 AATTTCTGGTGTGTGTGTGAAGG - Intergenic
1178510776 21:33203158-33203180 TGTGTGTGCTGTGTGGGTGGTGG - Intergenic
1179279225 21:39920011-39920033 TGTGTGTGGTGTGTGGGTGTAGG + Intronic
1179279227 21:39920038-39920060 TATGTGTGGTGTGTGTGTGTAGG + Intronic
1179286957 21:39985707-39985729 TGTGTGTGGTGTGTGTGATGTGG - Intergenic
1179304056 21:40138939-40138961 TATATGGGGTGTGTGTGGTGTGG + Intronic
1179304079 21:40139155-40139177 TATGTGGGGTGTGTGTGGTGTGG + Intronic
1179451032 21:41468616-41468638 CATCTGTGTAGTGCGTGTGGAGG - Intronic
1179467278 21:41584707-41584729 GGTATGTGGTGTGTGTGTGGGGG - Intergenic
1179532064 21:42026433-42026455 TGTGTGGGGTGTGTGTGTGGAGG + Intergenic
1179532230 21:42027736-42027758 GTTGTGTGGTGTGTGTGGGGGGG + Intergenic
1179769587 21:43604587-43604609 TATGTGTGATGTGTGTATGGTGG - Intronic
1179769625 21:43605039-43605061 GGTGTCTGGTGTGTGTGTGGTGG - Intronic
1179769639 21:43605204-43605226 TGTGTGTGGTGTGGGTGTGTGGG - Intronic
1179769665 21:43605370-43605392 TGTGTGTGGTGTGTGTGTCGGGG - Intronic
1179800139 21:43807898-43807920 TAGCAGGCGTGTGTGTGTGGTGG + Intergenic
1179998275 21:44984003-44984025 TATGTGGGGTGTGAGTGTGTGGG - Intergenic
1179998286 21:44984056-44984078 GGTGTGTGGGGTGTGTGTGGGGG - Intergenic
1180009894 21:45042701-45042723 TGTGTGTGGTGTGTGTGTGGTGG + Intergenic
1180108502 21:45636181-45636203 GGTGTGTGATGTGTGTGTGGTGG + Intergenic
1180108519 21:45636456-45636478 TGTGTGTGATGTGTGTGTGGTGG + Intergenic
1180144090 21:45909961-45909983 TATCTGGGAAGTGTGTGTGGGGG - Intronic
1180273579 22:10624915-10624937 TGTTTGTGGAGAGTGTGTGGTGG + Intergenic
1180986834 22:19909845-19909867 TGTGTGTGGTGTGTGTGTGAAGG - Intronic
1181434863 22:22904836-22904858 TCTCTGTGGGTTGAGTGTGGGGG + Intergenic
1181770020 22:25118620-25118642 AAGCTGTGGGGAGTGTGTGGGGG - Intronic
1181794901 22:25300358-25300380 CATGTGTGGTGTGTGTGTGTAGG + Intergenic
1181826593 22:25521333-25521355 TATTTCTGGTGTGTCTGTGAGGG - Intergenic
1181921922 22:26327281-26327303 TGTGTGTGGTATGTGTGGGGTGG - Intronic
1181921928 22:26327329-26327351 TGTGTGTGGTGTGTGTGTGGGGG - Intronic
1181932019 22:26409492-26409514 TATATGTAGGGTGGGTGTGGGGG - Intergenic
1181997152 22:26892036-26892058 TATGTTTTATGTGTGTGTGGGGG + Intergenic
1182022573 22:27093681-27093703 TATGTGTGGTGTGTGTGTATTGG - Intergenic
1182067029 22:27438226-27438248 TGTGTGTGGTGTGTGTTTGCAGG - Intergenic
1182432517 22:30308433-30308455 TATGTGTGTTGTGTTTGTGTGGG - Intronic
1182550163 22:31096672-31096694 CATCTGTGCTGTGTGGGTGTTGG + Intronic
1182712197 22:32330077-32330099 AGGCTCTGGTGTGTGTGTGGGGG + Intergenic
1182712307 22:32330619-32330641 AAGCTCTGGTGTGTGTGTTGGGG + Intergenic
1182713597 22:32337809-32337831 CATCTGTTGTGTCTGTATGGTGG - Intergenic
1182901278 22:33900317-33900339 TACCTGAGCTGTGTGTTTGGTGG - Intronic
1182973298 22:34598057-34598079 TATCAGGGGTGTGAGAGTGGTGG + Intergenic
1183062157 22:35342828-35342850 TAGGTGTGGTGTGTGTGTAGGGG - Intronic
1183062235 22:35343329-35343351 TGTGTGTGGTGTGTGTGTGGGGG - Intronic
1183265895 22:36824920-36824942 TGTGTGTGTGGTGTGTGTGGGGG + Intergenic
1183267488 22:36838178-36838200 TGTGTGTGGTGTGTGTGTGTGGG + Intergenic
1183267490 22:36838180-36838202 TGTGTGGTGTGTGTGTGTGGGGG + Intergenic
1183267512 22:36838341-36838363 TGTGTGTGATGTGTGTGTGGGGG + Intergenic
1183813242 22:40275975-40275997 TTTTTTTGGTGTGTGTGTGGGGG - Intronic
1183876090 22:40783267-40783289 TATTTGTTGTGTGTGTATGTGGG + Intronic
1184239841 22:43206297-43206319 TGACTGTGGTGTGTGTGTAGGGG - Intronic
1184239849 22:43206357-43206379 GCTGTGTGGTGTGTTTGTGGAGG - Intronic
1184399348 22:44264769-44264791 GGGCTGTGGTGTGTGTGTTGGGG - Intronic
1184399393 22:44264985-44265007 TCTCTGTTGTGTGTGTGTTAAGG - Intronic
1184400866 22:44273362-44273384 CATCTGTTGTGTCTGTATGGTGG - Intronic
1184454987 22:44604912-44604934 GATATGTGGTGTGTGTGTGCAGG - Intergenic
1184748012 22:46467303-46467325 TGTCTTTGGTGTGTGTGTTTGGG - Intronic
1184752910 22:46499251-46499273 CCTCTGTGGTTTCTGTGTGGGGG - Intronic
1184834794 22:47014780-47014802 TGTGTGTGGGGTGGGTGTGGTGG + Intronic
1184880961 22:47303934-47303956 TGTGTGTGGTGTGTGTGTGGGGG + Intergenic
1184924614 22:47628192-47628214 TGTGTGTTGGGTGTGTGTGGAGG + Intergenic
1185048735 22:48542257-48542279 TGTGTGTGTGGTGTGTGTGGGGG + Intronic
1185056827 22:48584744-48584766 GGTGTGTTGTGTGTGTGTGGAGG - Intronic
1185107477 22:48882566-48882588 TATGTGTGGTGTCTGTGCAGTGG - Intergenic
1185119371 22:48956866-48956888 TGTGTGTGGTGTGTGTGTGGGGG - Intergenic
1185212731 22:49580590-49580612 TATATGGTGTGTGTGTGTGTGGG - Intronic
1185281906 22:49975859-49975881 TGTGTGTGTGGTGTGTGTGGTGG + Intergenic
1185351004 22:50338400-50338422 TGTGTGTGGTATGTGTGTGTAGG + Intergenic
1185351041 22:50338804-50338826 TGTCTGGTGTGTGTGTGTGTAGG + Intergenic
1185351231 22:50340506-50340528 TGTGTGTGTGGTGTGTGTGGGGG + Intergenic
1185403191 22:50629003-50629025 TGTCTGTTGTGTGCGTGTGGTGG + Intergenic
949136516 3:573799-573821 TGTTTGTGGAGAGTGTGTGGTGG - Intergenic
949417285 3:3828487-3828509 AATCTTAGGTGTGTGTGTGTGGG - Intronic
949768102 3:7549296-7549318 TATCTGTTGGGTCTGTATGGTGG + Intronic
950627012 3:14254601-14254623 TATCTTGTGTGTGTGTGTTGGGG + Intergenic
950676748 3:14558741-14558763 TCTCTGGGGTGGGTGTGTAGGGG - Intergenic
950752052 3:15137409-15137431 TTTCTCTGTTGTATGTGTGGGGG + Intergenic
950916902 3:16655403-16655425 TATCTGTGGATTGTGTGGGAAGG + Intronic
952603241 3:35110142-35110164 TATCTGTGATGTGTGTATCAGGG - Intergenic
952818963 3:37469374-37469396 TGTCCATGCTGTGTGTGTGGTGG + Intronic
953531231 3:43741356-43741378 GGTGTGTGGTGTGTGTGTGTGGG - Intergenic
953557663 3:43959734-43959756 TGTCTGTGGTGGGTGGGTGTGGG - Intergenic
953869960 3:46617965-46617987 TTTCTGCAGTGTGTGTGTGAGGG - Intronic
953967503 3:47321001-47321023 TCTCTGAGGTGTGTGTCTGAAGG + Intronic
954984409 3:54776833-54776855 TATCCCTGCTGTGTGGGTGGTGG + Intronic
955333251 3:58064850-58064872 TCTGTGTGGTGTGTGTGTGGCGG - Intronic
955588689 3:60510717-60510739 TTTCTATATTGTGTGTGTGGGGG - Intronic
956130904 3:66053089-66053111 TGTCTGAGTTGTGTGGGTGGAGG - Intergenic
956749982 3:72337617-72337639 TATGTGTGTGGTATGTGTGGTGG + Intergenic
956749991 3:72337682-72337704 ATTGTGTGGTGTGTGTGTGGGGG + Intergenic
957017539 3:75085765-75085787 TATTTGGGGTGTGTCTGTGAGGG + Intergenic
957290819 3:78276167-78276189 TACCTGTGGTGTTTGTTTTGTGG + Intergenic
957341067 3:78897306-78897328 CATCTGTGGGGTGTGGGTGGAGG - Intronic
957744025 3:84315625-84315647 TGTGTGTGGTGTGTGTTTAGAGG + Intergenic
958487392 3:94730063-94730085 TATCTTAGGTGTGTCTGTGAGGG - Intergenic
958547207 3:95568912-95568934 TATCTGGGGTGTGTTTTTTGGGG - Intergenic
959024838 3:101229323-101229345 TACTGCTGGTGTGTGTGTGGGGG - Intronic
959548044 3:107620924-107620946 TTTCTGCGGAGTGTGTGTGTGGG + Intronic
960708628 3:120505530-120505552 TTCCTGGTGTGTGTGTGTGGTGG - Intergenic
960815495 3:121667836-121667858 TGTTAGTGGTGTGTGTGTGTTGG + Intronic
961790214 3:129370579-129370601 TATGTGTGTGGTGTGTGTGGTGG + Intergenic
961966820 3:130913613-130913635 TTTTTTTGGTGTGTGTATGGGGG + Intronic
962092829 3:132263026-132263048 TGTGTGTGGTGTGTGTGAGTGGG - Intronic
962925880 3:139993084-139993106 TTTCTGTTGTGTGTGTGTATGGG + Intronic
963059476 3:141213248-141213270 CATCTGTAGTGTGGCTGTGGGGG - Intergenic
964477753 3:157111750-157111772 TCTCTGTGGTTTGGCTGTGGTGG + Intergenic
964526735 3:157622665-157622687 TCACTTTTGTGTGTGTGTGGTGG + Intronic
964659979 3:159109645-159109667 TTTCTTTGGTGTGGGTGTGTGGG + Intronic
965246969 3:166285159-166285181 TATCAGTGGTGTGTTTCTTGAGG - Intergenic
965409319 3:168310230-168310252 TATGCATTGTGTGTGTGTGGGGG + Intergenic
966214812 3:177491297-177491319 TGTTTGTTGTGTGTGTCTGGAGG + Intergenic
966925753 3:184643569-184643591 TGTCTTTGGGGTGTGTGTGTTGG + Intronic
967039416 3:185676279-185676301 AATTTGAGGTGTGTGTGAGGGGG - Intronic
967089719 3:186125269-186125291 TGTATGTGGTGTGTGTGGTGTGG + Intronic
967165147 3:186773504-186773526 CACCCATGGTGTGTGTGTGGGGG - Intergenic
967217550 3:187223230-187223252 TATCTGTGGGGTGTTTGGAGGGG + Intronic
967316818 3:188157669-188157691 AGTGTGTGGTGTGTGTGAGGGGG + Intronic
967512085 3:190323547-190323569 TGTGTGTGGTGCGAGTGTGGTGG + Intronic
967533419 3:190575271-190575293 CATCTGTAGTGTGTATGTGCTGG + Intronic
967703118 3:192617877-192617899 TATGTCTGGATTGTGTGTGGAGG - Intronic
967744551 3:193040549-193040571 TGTTTTGGGTGTGTGTGTGGTGG + Intergenic
967853145 3:194097245-194097267 TGTGTGTGGTGTGTGTGTGTAGG + Intergenic
967862782 3:194164943-194164965 AGTCTGGTGTGTGTGTGTGGTGG - Intergenic
968130572 3:196190598-196190620 TATCTGGGGGGTGGGGGTGGTGG - Intergenic
968194531 3:196695452-196695474 GGTATGTGGTGTGTGGGTGGCGG - Intronic
968539357 4:1155683-1155705 TGTGTGTGGTGTGTGTGTGTTGG - Intergenic
968548308 4:1209864-1209886 TGTCTGTGGTGTGAGCCTGGCGG - Intergenic
968631144 4:1652451-1652473 TGTGTGTCGTGTGTGTGGGGTGG - Intronic
968631196 4:1652937-1652959 TCTGTGTGGTATGTGTGTGGTGG - Intronic
969312477 4:6362016-6362038 TGTTTGGGGTGTGTGTGTGTTGG + Intronic
969316558 4:6384946-6384968 TATCTGTAGTGTGCTTATGGTGG + Intronic
969325415 4:6441290-6441312 TCACTGTGGTGTCGGTGTGGAGG - Intronic
969339964 4:6534393-6534415 TGTATGTGTTGTGTGTGTGTTGG - Intronic
969555557 4:7906644-7906666 TAGCTGTGCTGTGAGTTTGGAGG - Intronic
969676832 4:8619001-8619023 TAACTGTGGGGTGGGTATGGGGG + Intronic
969687935 4:8686886-8686908 TGTGTGTGGTGTGTGTGTGGAGG + Intergenic
969687949 4:8687059-8687081 GGTGTGTGGTGTGTGTGTGTGGG + Intergenic
969861357 4:10038176-10038198 TATTTGTGAAGTGTGTGTGAGGG + Intronic
970178482 4:13363213-13363235 CATCTGTGGTGTGTGTATTCAGG - Intronic
970979250 4:22077561-22077583 TGTATCTGGTGGGTGTGTGGTGG - Intergenic
971041208 4:22754236-22754258 CATTTTTTGTGTGTGTGTGGGGG - Intergenic
971114658 4:23630759-23630781 GGTATGTGTTGTGTGTGTGGTGG - Intergenic
971366287 4:25979618-25979640 TGTCTGGGGTATGTGTGTGTGGG - Intergenic
971391733 4:26192423-26192445 CATCTGTGTTGTGTATATGGGGG - Intronic
971701045 4:29977020-29977042 AATCTGTGGTGTTTCTATGGAGG - Intergenic
971758373 4:30732637-30732659 TTTCAGTTGTGTTTGTGTGGAGG + Exonic
971864201 4:32147702-32147724 TTTATGGGGTGTGTGTGTGTTGG + Intergenic
973030130 4:45327126-45327148 TATTTCTGGTGTGTCTGTGAGGG - Intergenic
973265509 4:48206605-48206627 TTTCTCTGGTGTGTGTGTAGTGG - Intronic
973567121 4:52199753-52199775 TATGTGTGTGGTGTGTGTGTGGG + Intergenic
973567133 4:52199813-52199835 TGTGTGTGGTGTATGTGTGGGGG + Intergenic
973567138 4:52199834-52199856 GGTGTGTGGTGTGTGTGTGGGGG + Intergenic
974189086 4:58480158-58480180 TATCTTTCCTTTGTGTGTGGTGG - Intergenic
974718979 4:65711934-65711956 TGTGTGGGGTGTGTGTTTGGGGG - Intergenic
974996832 4:69171160-69171182 GATATGTGGTGTGTAGGTGGAGG - Intronic
975034946 4:69668564-69668586 TCCTTGTGATGTGTGTGTGGAGG - Intergenic
975190204 4:71451690-71451712 TGGGTGTGGTGGGTGTGTGGGGG + Intronic
975621689 4:76302996-76303018 TAGCTCTGGAGTGTTTGTGGGGG - Intronic
975622524 4:76308327-76308349 TTTATGTGGTGTGGGGGTGGTGG - Intronic
975977482 4:80115775-80115797 TATCTGTAATATGTGTGTGGGGG - Intronic
975986843 4:80207947-80207969 TGTATGTGGTGTGTTTGTGTGGG - Intergenic
975986851 4:80207999-80208021 TGTATGTGGTGTGTGTGGTGTGG - Intergenic
975986858 4:80208062-80208084 TGTGTGTGGTGTGTGTGGTGTGG - Intergenic
976051726 4:81017864-81017886 CACTTGTGGTGTGTGTTTGGGGG + Intergenic
976663734 4:87567807-87567829 TGATTGGGGTGTGTGTGTGGGGG - Intergenic
976819643 4:89190987-89191009 TAGATGTTGTGTGTATGTGGGGG - Intergenic
977135300 4:93296294-93296316 TATCTGTGGGGTGGGAGGGGGGG - Intronic
977476179 4:97512851-97512873 TGTATGAGGTGTGTGTGTTGTGG - Intronic
977836030 4:101647362-101647384 TGTGTGTGTGGTGTGTGTGGTGG + Intronic
978466513 4:109014739-109014761 GATGTATGGTGTGTGTGTTGGGG + Intronic
978592308 4:110337946-110337968 TAACTGTTCTGTATGTGTGGTGG + Intergenic
979004298 4:115270664-115270686 TCTCTCTCGTGTGTGTGTGTGGG + Intergenic
979774580 4:124573200-124573222 TCTGTGTGGTGTGTCTGTGAGGG - Intergenic
980503013 4:133681762-133681784 TGTATGTGGTGTATGTGTAGGGG + Intergenic
981823991 4:148918423-148918445 TATTTGAGTTGTGTGTGTCGGGG + Intergenic
981857098 4:149307696-149307718 TATTTCTGGTGTGTCTGTGATGG + Intergenic
982123732 4:152166361-152166383 CTTCTGGGGTGTGTGTGTGAGGG - Intergenic
982619633 4:157688276-157688298 TATCTGTGGTGTGTCTTATGTGG + Intergenic
982994143 4:162318674-162318696 TAGATGTGTTGTGTGTGTGCAGG - Intergenic
983518199 4:168678865-168678887 TGGGTGTGGCGTGTGTGTGGTGG + Intronic
983518290 4:168679332-168679354 TGTGTGTGGTGGGTGTGTGGTGG + Intronic
983518308 4:168679430-168679452 TGTGTGGGGTGTGTGTGTGGTGG + Intronic
983588762 4:169384354-169384376 TATATGTGGGCTGAGTGTGGTGG + Intergenic
983642977 4:169960814-169960836 TGTGTGTGGGGTGTGTGTGTGGG + Intergenic
983642979 4:169960816-169960838 TGTGTGGGGTGTGTGTGTGGGGG + Intergenic
983923543 4:173371671-173371693 TGTGTGTGGTGTGTGTGTTGGGG - Intronic
984293675 4:177827204-177827226 TATCTGTGGTTTCTGGCTGGAGG + Intronic
984529258 4:180895926-180895948 TATCTTTGGGCTGGGTGTGGTGG - Intergenic
985070199 4:186160002-186160024 TTTGTGTGGGGGGTGTGTGGGGG - Intronic
985656452 5:1134025-1134047 TGTCTGGGGTGGGTCTGTGGTGG - Intergenic
985821958 5:2166546-2166568 TGACTGTGGTGGGAGTGTGGGGG + Intergenic
985963676 5:3323551-3323573 TGTATGTGGTGTGTGTTTTGTGG + Intergenic
986296983 5:6447678-6447700 TGTTTGTGGTGTGTGTGTGAGGG - Intergenic
986296992 5:6447803-6447825 GATATGTGTGGTGTGTGTGGGGG - Intergenic
986552712 5:8976263-8976285 TATTATAGGTGTGTGTGTGGTGG - Intergenic
986565880 5:9113457-9113479 TTTCTTTTTTGTGTGTGTGGTGG - Intronic
986793036 5:11181900-11181922 TGTATGTGTGGTGTGTGTGGAGG + Intronic
986793039 5:11181924-11181946 TATGTGTGTGGTGTGTGTGTGGG + Intronic
986793041 5:11181926-11181948 TGTGTGTGGTGTGTGTGTGGGGG + Intronic
986793057 5:11182039-11182061 TGTGTGTGGGGTGTGTGTGGGGG + Intronic
986799035 5:11240793-11240815 TGTGTGTGTTGGGTGTGTGGGGG - Intronic
986799043 5:11240835-11240857 TATGTGTTGGGTGTGTGTTGGGG - Intronic
986806374 5:11312142-11312164 TATGGGGAGTGTGTGTGTGGTGG - Intronic
986818842 5:11443386-11443408 GGTGTGTGGTGTGTGTGTGGGGG + Intronic
986818848 5:11443410-11443432 GGTGTGTGGTGTGTGTGTGTGGG + Intronic
986935936 5:12886736-12886758 CATGTGTGTTGGGTGTGTGGGGG - Intergenic
986961338 5:13216983-13217005 TAAGTGTGGTGTTTGTGTGTGGG - Intergenic
987286167 5:16459537-16459559 TATCTGTTGTGTGTATATGTAGG - Intronic
987728416 5:21734516-21734538 TAATTATGGTGTGTGTATGGGGG + Intergenic
987746738 5:21983856-21983878 TATCTGCGGTATATGTGTGTAGG - Intronic
987989145 5:25188652-25188674 TAACAGTGATGTGTATGTGGTGG - Intergenic
988527960 5:32002849-32002871 TATGTGGGGTGTGTGTGTGTTGG - Intronic
988527970 5:32002905-32002927 TGTGTGTGGTGTGTGTGTGGTGG - Intronic
988527976 5:32002965-32002987 TGTGTGTGGTGTGTGTGTGTTGG - Intronic
988528007 5:32003235-32003257 TGTGTGTGGTGTGTGTGTGAAGG - Intronic
988810255 5:34777856-34777878 GGTGTGTGGTGTGTGTGGGGGGG + Intronic
988995997 5:36715429-36715451 TGTGTGGGGTGTGTGCGTGGGGG - Intergenic
989025064 5:37058351-37058373 TTTGTGTGGTGTGTGTGTGTGGG - Intronic
989998504 5:50864104-50864126 TGTGTGTTGTGTGTGTGTGTTGG - Intergenic
990390705 5:55317047-55317069 TTTCTAGGGTGTGTGTGTGTGGG - Intronic
990528142 5:56649029-56649051 TATCTGTGGTATTGGTATGGTGG - Intergenic
990791268 5:59482909-59482931 CATCTGGGGTATGTGTGTGAGGG + Intronic
991224417 5:64252929-64252951 CATTTGAGGTGTGTGTGTGCTGG - Intronic
991466002 5:66912874-66912896 TAGATGTGGTGTGTGTTGGGAGG - Intronic
991766910 5:69993616-69993638 TATCTGTGGTATATGTGTGTGGG - Intergenic
991846142 5:70868693-70868715 TATCTGTGGTATATGTGTGTGGG - Intergenic
992530827 5:77650341-77650363 TTTCAGGAGTGTGTGTGTGGAGG + Intergenic
992559269 5:77934107-77934129 TATATGTGGTGTATGAGTGGTGG - Intergenic
993434181 5:87871166-87871188 TTAATGTAGTGTGTGTGTGGGGG - Intergenic
993800770 5:92332987-92333009 TATGTGTGTTGTGTGTGTGTGGG + Intergenic
993854116 5:93051655-93051677 TCTATGAGGTGTGTGGGTGGCGG - Intergenic
994684792 5:102936107-102936129 CATCTGTTGTATCTGTGTGGTGG + Intronic
994685117 5:102941158-102941180 TATAATTGCTGTGTGTGTGGAGG - Intronic
994931936 5:106200128-106200150 TATTTATGGTGTGTGTGGGAGGG - Intergenic
995275716 5:110275430-110275452 TATCTGATGTGTCTGTGTGGAGG + Intergenic
995348777 5:111151316-111151338 TTTCTGAGGTGAGTATGTGGAGG - Intergenic
995569092 5:113460457-113460479 TGTGTGTGGTGTGTGTTTGGGGG - Intronic
995631586 5:114139463-114139485 TTTCTGGTGTGTGTGTGTGGGGG - Intergenic
995740393 5:115349967-115349989 CATCTTTGGTCTGTGTGTAGAGG + Intergenic
995934144 5:117487807-117487829 AATCTGTGGGTTGGGTGTGGTGG + Intergenic
995968054 5:117933460-117933482 TATCTGTCTTGGGTGAGTGGTGG - Intergenic
996373839 5:122781959-122781981 TGTCTGTTGTGTCTGTATGGTGG + Intronic
996411162 5:123161171-123161193 TTGTTGTGGTGTGTGTGTTGAGG + Intronic
996739671 5:126787502-126787524 TATATAACGTGTGTGTGTGGGGG + Intronic
997232759 5:132256374-132256396 TATTTGGGGTGTGTGTGTGGGGG - Intronic
998103385 5:139452384-139452406 TATTTGAGGTGTGTGTGTGGAGG + Intronic
998103407 5:139452494-139452516 TGTTTGTGATGTGTGTGGGGAGG + Intronic
998162561 5:139821811-139821833 GGTGTGTGCTGTGTGTGTGGGGG + Intronic
998187508 5:139993106-139993128 TGTGTGTGGTGTGTGTGTGGTGG + Intronic
998327668 5:141296297-141296319 TATATGTGGGCTGGGTGTGGTGG + Intergenic
998951084 5:147393641-147393663 TATTTGGGGTGAGTGGGTGGTGG - Exonic
999079125 5:148826704-148826726 CGGCTGTGGTGTGGGTGTGGTGG - Exonic
999178937 5:149655044-149655066 TATGTGTGTGGTGTGTGTGCAGG - Intergenic
999178974 5:149655395-149655417 TGTGTGTGGTGTGTGTGTGGGGG - Intergenic
999178995 5:149655534-149655556 TGTGTGTGGTGTGTGTGGGGGGG - Intergenic
999218200 5:149953980-149954002 GATGTGGGGTGTGTTTGTGGTGG - Intergenic
999304755 5:150512232-150512254 TGAATGTGGTGTGTGTGTTGGGG + Intronic
999442415 5:151612729-151612751 TGTATGTGTGGTGTGTGTGGTGG + Intergenic
999442421 5:151612781-151612803 TGTGTGTGGTGTGTGTGGTGTGG + Intergenic
999442432 5:151612899-151612921 TGTGTGGTGTGTGTGTGTGGTGG + Intergenic
999938638 5:156516223-156516245 TATTGGGGGTGTGTGTGTGGGGG - Intronic
1000367371 5:160504353-160504375 TGTGTGTGGTGTATGTGTGTGGG + Intergenic
1000367488 5:160505145-160505167 TGTGTGTGGGGTGTGTGTGTGGG + Intergenic
1000615737 5:163424729-163424751 TATTTCTGGTGTGTCTGTGGGGG + Intergenic
1001076175 5:168629631-168629653 TATTTGGTGTGTGTGTGTGTTGG + Intergenic
1001091636 5:168746321-168746343 TATGTGGTGTGTGAGTGTGGTGG + Intronic
1001091711 5:168746704-168746726 GGTGTGTGGTGTGGGTGTGGCGG + Intronic
1001198245 5:169693001-169693023 AATTTGGGGTGTGTGTGTGGGGG + Intronic
1001211405 5:169813340-169813362 CATCTATTGTGTCTGTGTGGTGG + Intronic
1001410051 5:171505100-171505122 ATTGTGTGGTGTGTGTGTTGGGG + Intergenic
1001615946 5:173043688-173043710 TATCTGTGGTCTGGGTGTGGTGG - Intergenic
1002051762 5:176575437-176575459 GACCTGTGGGGTGTGGGTGGAGG + Intronic
1002172920 5:177385417-177385439 TCTCGGAGGGGTGTGTGTGGTGG - Intronic
1002345954 5:178547637-178547659 TATGGGGGGTGTGTGTGTGTGGG - Intronic
1002346001 5:178547775-178547797 TGTGTGTGGGGGGTGTGTGGGGG - Intronic
1002394909 5:178945130-178945152 TGTGTGTCGTGTGTGTGTTGAGG + Intronic
1002633322 5:180594967-180594989 TGTGTGTGGGGTGTGTGTGAGGG + Intergenic
1002799430 6:507246-507268 TCACTGCTGTGTGTGTGTGGGGG - Intronic
1002799435 6:507330-507352 CTGCTGTGGTGTGTGTGGGGGGG - Intronic
1002862778 6:1094955-1094977 TGTGTGTGGTGTGTGTGCCGGGG - Intergenic
1003463377 6:6352964-6352986 TATGTGTGGTGTGTGTGGTATGG - Intergenic
1003612378 6:7625602-7625624 TATGGGGGGTGTGTGTGTGGGGG + Intergenic
1003868925 6:10386437-10386459 TGTTTGTTGTGTGTGTGTTGTGG + Intergenic
1003887186 6:10532378-10532400 TTTCTGTGTTATGTGTGTGGAGG + Intronic
1003985085 6:11427394-11427416 TGTATGTGGTGTTTGTGTCGAGG - Intergenic
1004083740 6:12422965-12422987 TGTCTGTGCTGTTTGTCTGGAGG + Intergenic
1004149776 6:13105373-13105395 TGTCTCTGGCGTGTGTGTCGGGG + Intronic
1004191441 6:13467438-13467460 TTTATGGGCTGTGTGTGTGGTGG - Intronic
1004286887 6:14329493-14329515 TGTGTGTGGTGTGTGTGTGCAGG - Intergenic
1004290677 6:14364082-14364104 TACCTGTGGTGTCTGTGTCGGGG + Intergenic
1004321817 6:14637631-14637653 TATTTGTGGAGTGTGTGTGCTGG - Intergenic
1005077082 6:21919031-21919053 TATCTTGGGGGAGTGTGTGGAGG + Intergenic
1005164701 6:22906470-22906492 TGTGTGTGGTTTGTGTGTGTGGG - Intergenic
1005467837 6:26132558-26132580 TATTTTTTGTGTGTGTGTGGCGG + Intronic
1006342323 6:33453399-33453421 TATCCGGGGTGTGTGTGTGTGGG + Exonic
1006441806 6:34057953-34057975 TGTGTGTGGTGGGTGGGTGGAGG + Intronic
1007057493 6:38902327-38902349 TCTATCTGGTGGGTGTGTGGTGG + Intronic
1007226250 6:40317057-40317079 TATCTCTTGGCTGTGTGTGGTGG - Intergenic
1007413228 6:41677378-41677400 TATGTGTGGAGTGGGGGTGGGGG + Intergenic
1007842053 6:44724606-44724628 TTTCTGGTGTGTGTGTGTGTGGG + Intergenic
1008485728 6:52033349-52033371 ACTCTGTGTTGTGGGTGTGGGGG - Intronic
1008635634 6:53407754-53407776 TTTCTGGGTTGGGTGTGTGGAGG + Intergenic
1008639805 6:53450171-53450193 TCTCTGGGGTGTGGGTGTGGTGG + Intergenic
1008742840 6:54630582-54630604 TTTCTGGGGTGTGTCTGTGAGGG + Intergenic
1009052394 6:58292099-58292121 CTTTTGAGGTGTGTGTGTGGGGG - Intergenic
1009238714 6:61158515-61158537 CTTTTGAGGTGTGTGTGTGGGGG + Intergenic
1009463742 6:63945546-63945568 TATGTGTGGTGAGGGTGTGGAGG - Intronic
1010344254 6:74793532-74793554 TATTTTTTGTGTGTGTGTGGTGG + Intergenic
1010745973 6:79562206-79562228 TATGTGTGGTGTGTGTGTAATGG - Intergenic
1010924032 6:81721447-81721469 TATAGGTTGTGTGTGTGTGCTGG - Intronic
1011097155 6:83679040-83679062 TATTTTGTGTGTGTGTGTGGTGG - Intronic
1011466288 6:87660463-87660485 CATCTGTGGTGTGGCTGTTGAGG - Intronic
1012356075 6:98316147-98316169 TATGTGTGGTGTGGTTGTAGGGG - Intergenic
1012398877 6:98828289-98828311 TGTGTGTGGTGTGTGTGTGTTGG - Intergenic
1012823526 6:104120188-104120210 TATTGGGGATGTGTGTGTGGAGG - Intergenic
1013000012 6:106012574-106012596 TATGTGTGGTGTGTGTGATGTGG - Intergenic
1013028041 6:106298991-106299013 TATATGTGGTTTCTGTGTTGTGG - Intronic
1013229998 6:108153967-108153989 TATCTCTGGTGTGTGTTGGTGGG + Intronic
1013878211 6:114860609-114860631 TGTGTGTGGTGGGGGTGTGGAGG + Intergenic
1014330255 6:120055522-120055544 GGTCTGTGGTATGTTTGTGGAGG - Intergenic
1014417997 6:121208093-121208115 TTTTTTTGGTGTGTGTGTGAGGG - Intronic
1015945570 6:138496709-138496731 TATTTGTTGTGTGTGTGCGAGGG - Intronic
1016013376 6:139161036-139161058 TGTGTGTGGTGTGTGTGTGTCGG + Intronic
1016735839 6:147479204-147479226 TATTTCTGGTGTGTCTGTGAGGG - Intergenic
1017515545 6:155152795-155152817 GGCCTGTTGTGTGTGTGTGGTGG + Intronic
1018243708 6:161802440-161802462 CATATGTGGGGTGTGTGTGTGGG - Intronic
1019074045 6:169372707-169372729 GGTGTGTGGTGTGTGTGTTGTGG - Intergenic
1019339937 7:504228-504250 TGCCTGTGGTGGGTGGGTGGTGG - Intronic
1019482946 7:1274716-1274738 GCTCTGTGGTGTGTGTGGGGGGG + Intergenic
1019487268 7:1295106-1295128 TGTGTGTGGTGTGGGTGTGTGGG + Intergenic
1019487279 7:1295170-1295192 TGTGTGTGGTGTGGGTGTGTGGG + Intergenic
1019487345 7:1295480-1295502 TGTGTGTGGTGTGGGTGTGTGGG + Intergenic
1019510439 7:1414990-1415012 TGTGTTTGGTGTGTGTGTGAGGG - Intergenic
1019546858 7:1582057-1582079 CATATGTGGTGTGTTCGTGGAGG + Intergenic
1019553831 7:1618761-1618783 TATGAGGGGTGTGTGTGTGTAGG + Intergenic
1019721867 7:2577214-2577236 TGTGTGTGGTGTGTGTGCAGTGG + Intronic
1020127007 7:5538713-5538735 TGTGTGGGGTGTGTGTGTGTGGG - Intronic
1020127022 7:5538815-5538837 TGTGTGTGGTGTGTGGGTGTGGG - Intronic
1020214532 7:6179687-6179709 TGTGTGGGGTGTGTGTGTGGGGG - Intronic
1020214534 7:6179689-6179711 TGTGTGTGGGGTGTGTGTGTGGG - Intronic
1020214552 7:6179757-6179779 TGTGTGTGGGGTGTGTGTGGTGG - Intronic
1020214561 7:6179797-6179819 TGTGTGTGTGGTGTGTGTGGTGG - Intronic
1020952349 7:14696142-14696164 CATTTTTGGTGTGTGTGTTGGGG - Intronic
1021183437 7:17534891-17534913 TTTCTGAGGTGTGTGGGCGGGGG - Intergenic
1021652088 7:22842242-22842264 CATCTGGTGTATGTGTGTGGCGG - Intergenic
1022048163 7:26639630-26639652 TGTTTGTGGTGTGTGTGGGGGGG - Intronic
1022048170 7:26639679-26639701 TGTTTGTGGTGGGTGTGTGTGGG - Intronic
1022048434 7:26642486-26642508 TGTGTGTGTTGTGTGTGTGGTGG + Intronic
1022127010 7:27368297-27368319 TGTGTGTGGTGTGTGAGTGTGGG - Intergenic
1022585333 7:31603399-31603421 TGTCTGTGGAGTGGGTGGGGAGG - Intronic
1022712879 7:32868407-32868429 AACCTGTTGTGTGCGTGTGGGGG - Exonic
1022736368 7:33079925-33079947 CATTCCTGGTGTGTGTGTGGAGG + Intergenic
1022926478 7:35060134-35060156 TCTGTGTGGTGTGTGTCTGTGGG + Intergenic
1023079657 7:36515125-36515147 GGGGTGTGGTGTGTGTGTGGGGG - Intronic
1023079700 7:36515353-36515375 TGTGTGTGGTGTGTGTGTGGGGG - Intronic
1023079742 7:36515569-36515591 TATGTGTGTGGTGTGTGGGGGGG - Intronic
1023079848 7:36516295-36516317 TGTGTGTGGTATCTGTGTGGGGG - Intronic
1023331457 7:39121984-39122006 TATCTGTAGGCTGGGTGTGGTGG - Intronic
1023346020 7:39271973-39271995 GAGTTGGGGTGTGTGTGTGGGGG + Intronic
1023731755 7:43198271-43198293 TGTGTGTGGTGTGTGAGTGTGGG - Intronic
1024005135 7:45219782-45219804 TTGCTGAGGTCTGTGTGTGGGGG + Intergenic
1024197654 7:47074903-47074925 AATTTTTTGTGTGTGTGTGGGGG - Intergenic
1024207877 7:47179313-47179335 TATCTCTTGAGTGTGTGTTGGGG + Intergenic
1024308299 7:47946456-47946478 TGTGTGCGATGTGTGTGTGGTGG - Intronic
1024343894 7:48293201-48293223 TAGATTTAGTGTGTGTGTGGCGG - Intronic
1024524167 7:50334336-50334358 TACATGTGTTGTGTGTGTGCAGG + Intronic
1024524202 7:50334833-50334855 GATATGTGGTGTGTATGTGTGGG + Intronic
1024765981 7:52659891-52659913 TTTGGTTGGTGTGTGTGTGGTGG + Intergenic
1024787509 7:52925447-52925469 TTTCTCTCTTGTGTGTGTGGTGG + Intergenic
1026545491 7:71318414-71318436 TTTTTTTTGTGTGTGTGTGGGGG + Intronic
1026659220 7:72284429-72284451 TCTCTGTGATGTGTCTGTGAGGG + Intronic
1027266776 7:76498907-76498929 TGTGTGTGGAGTGTGTGTGGAGG + Intronic
1027318161 7:76997037-76997059 GAGGTGTGGAGTGTGTGTGGAGG + Intergenic
1027318288 7:76997585-76997607 TGTGTGGGGTGTGTGTGTGGAGG + Intergenic
1027699804 7:81455981-81456003 TCAGTCTGGTGTGTGTGTGGGGG + Intergenic
1027954128 7:84857871-84857893 TATTTGTTGTGTGTGTGTGTGGG - Intergenic
1027958398 7:84912512-84912534 TATATGAAGTGTGTGTGTGGGGG - Intergenic
1028113978 7:86976559-86976581 TATCTTTTGTGTGTGTGGAGGGG - Intronic
1028188341 7:87816414-87816436 TCTTTCTCGTGTGTGTGTGGGGG + Intronic
1028265187 7:88715279-88715301 TATTTGTGGTTTGTGGATGGAGG + Intergenic
1028375788 7:90145410-90145432 TCTGTGTGGTGTGTGTCTGTGGG - Intergenic
1028474927 7:91242765-91242787 TATTTGTAATGTGTTTGTGGGGG + Intergenic
1028723199 7:94057772-94057794 TATATGTGGTGTATGTGTGGCGG - Intergenic
1028760629 7:94492175-94492197 TATTTGTGGGGTGGGCGTGGTGG + Intergenic
1028820422 7:95204638-95204660 TATGTGTGGTGTGTGTGCATGGG - Intronic
1028820433 7:95204736-95204758 TATGTGTGGTGGGTGTGTGTGGG - Intronic
1028827167 7:95287140-95287162 TATCAGTGGGCTGTGTGTGGTGG + Intronic
1029420856 7:100471192-100471214 GATCTGTGGTGTCTTTGGGGCGG + Intronic
1029824484 7:103174828-103174850 TCTGTGTGGTGTGTGTCTGTGGG + Intergenic
1030272568 7:107686087-107686109 TCTCTGTGGTGTGTGTGTGTGGG + Intronic
1030816759 7:114048706-114048728 CATTTGTGGTGGGTGGGTGGGGG - Intronic
1030891335 7:115002877-115002899 TATGTGTAGTGAGTGTGTGTAGG + Intronic
1030909886 7:115233852-115233874 TATGTGTGTTGTGTGTGTTGGGG + Intergenic
1031010375 7:116520297-116520319 AATCTTGGGTGTGTCTGTGGAGG - Intergenic
1031132735 7:117851386-117851408 AATTTGTTGTGTGTGTGTGAGGG - Intronic
1031779857 7:125947450-125947472 CATTTCTGGTGTGTGTGTAGGGG + Intergenic
1032239820 7:130151859-130151881 GGTCTGTGGTGTGTGTGATGTGG - Intergenic
1032239868 7:130152484-130152506 TTTGTGTGGTGTGTGTTTTGTGG - Intergenic
1032858822 7:135858849-135858871 TGTCAGTGGGGTGGGTGTGGTGG + Intergenic
1033181325 7:139182080-139182102 ATGCTGGGGTGTGTGTGTGGAGG + Intronic
1033586686 7:142779601-142779623 TCTGGGTGGTGTGTGTGTGGGGG - Intergenic
1034341493 7:150359522-150359544 TGTGTGTGGTGTGTGTGTGGTGG - Intergenic
1034341573 7:150360152-150360174 TGTGTGTGGAGTGTGTGTGGTGG - Intergenic
1034428087 7:151025129-151025151 TCACTGTAGTGTGTGTGTGGAGG - Intergenic
1034636844 7:152574485-152574507 TATCTGTTTTGTGTGTGTGTGGG + Intergenic
1034841755 7:154404028-154404050 TCTCTGGGGTGTGTTTGTGAAGG - Intronic
1034858271 7:154574523-154574545 TATGTGTGGTGTGTATGGTGTGG + Intronic
1034858309 7:154575025-154575047 TGTGTGTGGTGTGTGTGGTGTGG + Intronic
1034969220 7:155408790-155408812 TATGTGTGGTGTGGGAGTGTGGG + Intergenic
1035170005 7:157011746-157011768 TATTTGAAGTGTGCGTGTGGGGG - Intergenic
1035206841 7:157299319-157299341 TGTGTGTGGTGTGTGTGGAGTGG + Intergenic
1035233585 7:157482338-157482360 TATGTGTGGTGTGTGTCGTGTGG + Intergenic
1035251053 7:157597266-157597288 TACCTGTATTGTGTGTGTTGTGG - Intronic
1035283163 7:157789936-157789958 GGTATGTGGTGTGTGTGTGGTGG + Intronic
1035283183 7:157790073-157790095 TGTGTGTGTGGTGTGTGTGGTGG + Intronic
1035283188 7:157790117-157790139 TGTGTGTGGTGTGTGTGTGGTGG + Intronic
1035283196 7:157790163-157790185 TGTGTGTGGTGTGTGTATGGTGG + Intronic
1035283213 7:157790283-157790305 TGTGTGTGGTGTGTGTATGGTGG + Intronic
1035288281 7:157820049-157820071 GATCTGCTGTATGTGTGTGGTGG - Intronic
1035420155 7:158723286-158723308 TGTGTGTGGTGTGTGTGTGATGG + Intergenic
1035634396 8:1133017-1133039 AATCTGGGGTCTGTGTGTGGTGG + Intergenic
1035687625 8:1537316-1537338 TGTGTGTGGTGAGTGTGTGTTGG + Intronic
1035922595 8:3693992-3694014 TGTGTGTGTTGTGTGTGTTGGGG + Intronic
1036086531 8:5618639-5618661 GGTCTTGGGTGTGTGTGTGGGGG + Intergenic
1036246169 8:7118931-7118953 TTTCTCTGTTGTATGTGTGGGGG + Intergenic
1037518414 8:19656597-19656619 GATCTCGTGTGTGTGTGTGGGGG - Intronic
1037764963 8:21767045-21767067 TGCCTGTGATGCGTGTGTGGTGG - Intronic
1037764987 8:21767231-21767253 TGTATGTGATGTGTGTGAGGTGG - Intronic
1037764995 8:21767302-21767324 GAGGTGGGGTGTGTGTGTGGAGG - Intronic
1038678020 8:29641255-29641277 CATGCGTGCTGTGTGTGTGGTGG + Intergenic
1038837075 8:31137756-31137778 TATATTGGGTGTGTGTGTGGAGG + Intronic
1039378832 8:37065641-37065663 AAAATGTGGTGTGTGTGTGTGGG + Intergenic
1039477995 8:37851189-37851211 TCTGAGTGGTGTGTGTGTGCGGG - Intergenic
1039527181 8:38227177-38227199 TGTCTGTGATGTGTCTGTGAGGG - Intronic
1039610883 8:38918389-38918411 TGTCTGTGGTATGTGTATGGGGG - Intronic
1039913728 8:41844507-41844529 TGTGTGTGGGGGGTGTGTGGTGG - Intronic
1040474399 8:47763966-47763988 TGTGTGTGGTGTGTGTGTGATGG + Intergenic
1040474416 8:47764111-47764133 TGTGTGTGTTGTGTGTGTGATGG + Intergenic
1040580199 8:48692046-48692068 GATCTCTGGTATCTGTGTGGTGG - Intergenic
1040811789 8:51461595-51461617 TATGGGTGGTGTGTTTGTGTAGG - Intronic
1040887029 8:52276020-52276042 TGCATGTGGTGTGTGTGTGGGGG - Intronic
1041173380 8:55168273-55168295 TGTTTTTGGTTTGTGTGTGGTGG + Intronic
1042142065 8:65688855-65688877 TATATGTGGGCTGGGTGTGGTGG + Intronic
1042444339 8:68866704-68866726 TGTGTGTGGTGTGTGTGTTGGGG + Intergenic
1042840473 8:73118385-73118407 TGTGTGTGGTGTGTGTGTGTGGG + Intronic
1043099835 8:76029375-76029397 TATGTGTGGGGTGTGTGTGTGGG - Intergenic
1043148514 8:76683404-76683426 TTTGTTTGGTGTGTGTGTGGGGG - Intronic
1043345134 8:79289186-79289208 TGTGTGTGGTGTGTGTGTCGTGG + Intergenic
1043540441 8:81256150-81256172 TTTTTTTGGTGTGTGTGTGGGGG + Intergenic
1043826829 8:84939097-84939119 TATATGTGTTGTGAGTGTGATGG + Intergenic
1043885090 8:85589825-85589847 CATTCCTGGTGTGTGTGTGGTGG - Intergenic
1044181154 8:89196825-89196847 TATTTTTTGTGTGTGTGTGAGGG - Intergenic
1044669867 8:94668418-94668440 TATGTGTTGTGTGTGTGTACAGG - Intronic
1044734444 8:95265117-95265139 TCTCTGGGGTGTGTATGTGGGGG + Intronic
1044745457 8:95366481-95366503 TATGAATGGTGTGTGTGTAGGGG + Intergenic
1044810459 8:96056130-96056152 TATATGTGGTGTGTGGGTGGTGG - Intergenic
1045350837 8:101337791-101337813 TGTATGTGTTGTGTGTGTGCTGG + Intergenic
1046247297 8:111581151-111581173 TAAACGTGGTGTGTGTGGGGGGG + Intergenic
1046312703 8:112459339-112459361 TGTGTGTTGTGTGTGTGTGTGGG + Intronic
1046377226 8:113399685-113399707 TTTCTTTGATGTGTGTGTTGTGG + Intronic
1046521616 8:115332961-115332983 AATGTGTGATGTGTGTGTGGGGG + Intergenic
1046654580 8:116879268-116879290 TCTCAGTTGTGTGTGTGGGGGGG - Intergenic
1046736871 8:117786229-117786251 CATCTGTATTGTGTTTGTGGTGG - Intergenic
1046957029 8:120072331-120072353 CCACTGTGGTGAGTGTGTGGTGG + Intronic
1046967525 8:120184194-120184216 TGTTTGTGGTGTGTGTGTGGGGG + Intronic
1047093504 8:121598910-121598932 GTTTTTTGGTGTGTGTGTGGGGG + Intergenic
1047198906 8:122747072-122747094 TATCCTTGGTGTGTCTGTGACGG - Intergenic
1047498080 8:125422610-125422632 TGTGTGTGGGGTGTGTGTGTGGG + Intergenic
1047498102 8:125422700-125422722 TGTGTGTGGGGTGTGTGTGTGGG + Intergenic
1047498105 8:125422713-125422735 TGTGTGTGGGGTGTGTGTGTGGG + Intergenic
1047498108 8:125422726-125422748 TGTGTGTGGGGTGTGTGTGTGGG + Intergenic
1047498116 8:125422763-125422785 TGTGTGTGGGGTGTGTGTGTGGG + Intergenic
1047498122 8:125422787-125422809 TGTGTGTGGGGTGTGTGTGTGGG + Intergenic
1047715311 8:127589833-127589855 TATGTCTGGCCTGTGTGTGGGGG - Intergenic
1047947273 8:129894132-129894154 TATATGTAGTGTGTGTATGGAGG - Intronic
1048216041 8:132496095-132496117 TGTATGTGCAGTGTGTGTGGGGG + Intergenic
1048216054 8:132496319-132496341 TATGTGTGCAGTGTGTGTGGAGG + Intergenic
1048254163 8:132893103-132893125 TGTGTGTGGTATATGTGTGGAGG + Intronic
1048292944 8:133194326-133194348 TGCCTGTGTGGTGTGTGTGGGGG + Intronic
1048292947 8:133194328-133194350 CCTGTGTGGTGTGTGTGGGGGGG + Intronic
1048292990 8:133194540-133194562 TGTATGTGGTGTGTGTGGGGGGG + Intronic
1048293004 8:133194588-133194610 TGTGTGGGGTGTGTGTGTGTGGG + Intronic
1048293019 8:133194677-133194699 TGTGTGTGGTGTGTGTGTGGAGG + Intronic
1048306835 8:133290312-133290334 TTTTTGTGGTGTGTCTGTGTAGG - Intronic
1048307674 8:133295484-133295506 GTTCTGTGTGGTGTGTGTGGCGG - Intronic
1048321633 8:133404819-133404841 TATGTGTGTGGTGTGTGTGTGGG - Intergenic
1048441294 8:134461330-134461352 TATTTGTGGTATGTGTGGTGTGG + Intergenic
1048441316 8:134461645-134461667 TATGTGTGGCGTGTGTGGTGTGG + Intergenic
1048563432 8:135567726-135567748 AATCTGTGGTGTTGGGGTGGTGG - Intronic
1048871783 8:138804893-138804915 TGTGTGTGGTGGGTGTGTGATGG + Intronic
1048957889 8:139551873-139551895 CAGCTATGGTGTGTGTGTGGTGG - Intergenic
1049031007 8:140037736-140037758 TGTGTGGGGTGTGTGTGTGTGGG - Intronic
1049335438 8:142082104-142082126 TGTCTGGGATGTGTGTGTGTGGG - Intergenic
1049335465 8:142082241-142082263 TGTCTGGGATGTGTGTGTGGGGG - Intergenic
1049335484 8:142082326-142082348 TGTCTGGGATGTGTGTGTGTGGG - Intergenic
1049335550 8:142082722-142082744 TGTCTGGGATGTGTGTGTGTGGG - Intergenic
1049335638 8:142083207-142083229 TGTCTGGGGTGTGTGTCTGGGGG - Intergenic
1049504735 8:142990111-142990133 CATGTGTGTGGTGTGTGTGGGGG + Intergenic
1049504747 8:142990185-142990207 TCTGTGTGGTGTGGGTGTGTGGG + Intergenic
1049654203 8:143790656-143790678 CATCTGTGCTGCGTGCGTGGGGG + Intergenic
1049939520 9:531849-531871 TGTGTGTGTTGTGTGTGTGTGGG + Intronic
1050244911 9:3678952-3678974 TAAATGTTGTATGTGTGTGGAGG - Intergenic
1050413079 9:5386491-5386513 GTTTTGTTGTGTGTGTGTGGGGG - Intronic
1050957525 9:11683644-11683666 AATATGTGGTGTGTGTGTGGCGG + Intergenic
1051257201 9:15226669-15226691 TTTCTGTGGTGTGTATTTAGTGG - Intronic
1051318280 9:15868104-15868126 AATGTGTGGTGTGGTTGTGGTGG + Intronic
1052206616 9:25848726-25848748 TACCTTTTGTGTGTGTGTGTGGG - Intergenic
1052438382 9:28460803-28460825 AGTGTGTGGTTTGTGTGTGGGGG + Intronic
1052501109 9:29291560-29291582 TAGTTATCGTGTGTGTGTGGGGG + Intergenic
1052507825 9:29378084-29378106 GTTTTGTGGTGTGCGTGTGGTGG + Intergenic
1052647516 9:31254795-31254817 TTCCTTTGGTGTGTGTGTGGAGG - Intergenic
1052662327 9:31449809-31449831 TGCCTGTGGTGTGTGTGTGTGGG - Intergenic
1052973430 9:34394662-34394684 TGTGTGTGGGGTGTGTGTTGGGG + Intronic
1053273192 9:36764053-36764075 TTTATGTGGTGTGTGTGTTGTGG + Intergenic
1053748549 9:41229977-41229999 TGTGTGTGGTGTATGTGTGTGGG + Intergenic
1053748581 9:41230316-41230338 TTTGTGTGGTGTCTGTGTGTGGG + Intergenic
1054337797 9:63823069-63823091 TTTGTGTGGTGTCTGTGTGTGGG - Intergenic
1055602728 9:77936708-77936730 CATGTGTGGTGTGAGTGCGGGGG - Intronic
1055893928 9:81153746-81153768 GTTCAATGGTGTGTGTGTGGAGG - Intergenic
1056193347 9:84206130-84206152 TGTGTGTGGTGTGTGTGGGGTGG + Intergenic
1056193372 9:84206288-84206310 TGTGTGTGGTGTGTGTGGGGTGG + Intergenic
1056193424 9:84206527-84206549 TGTGTGTGGTGTGTGTGGGGTGG + Intergenic
1056222843 9:84467280-84467302 TGTGTGTGGTGTGTGTGTGGGGG + Intergenic
1056222848 9:84467293-84467315 TGTGTGGGGGGTGTGTGTGGGGG + Intergenic
1056222853 9:84467308-84467330 TGTGGGGGGTGTGTGTGTGGGGG + Intergenic
1056380577 9:86053677-86053699 TGTGTGTGGTGTGTGTGGAGTGG - Intronic
1056558981 9:87713406-87713428 TGTGTGTGGTGTGTGTGTGGGGG + Intergenic
1056577879 9:87869790-87869812 TGTGTGTGGTGTGTGTGTGGTGG - Intergenic
1056577889 9:87869881-87869903 TGTGTGTGGTGTGTATGTGGTGG - Intergenic
1056579124 9:87877521-87877543 TTTCTGTGGGGTCTCTGTGGAGG + Intergenic
1056675350 9:88672296-88672318 TATGTATGGTGTGTGTGGTGTGG + Intergenic
1056753866 9:89370609-89370631 TGTCTGGGATGTGTGTGGGGGGG + Intronic
1056754062 9:89371518-89371540 GGGGTGTGGTGTGTGTGTGGGGG + Intronic
1056754116 9:89371746-89371768 CGGGTGTGGTGTGTGTGTGGGGG + Intronic
1056754128 9:89371789-89371811 TGTTTGGGGTGTGTGTGTGGGGG + Intronic
1056754145 9:89371851-89371873 TGTCTGAGGTGTGTGTGGGGGGG + Intronic
1056754196 9:89372077-89372099 TGTGTCGGGTGTGTGTGTGGGGG + Intronic
1056754206 9:89372115-89372137 TGTGTGGGGTGTGTGTGTTGGGG + Intronic
1056754215 9:89372147-89372169 TGTGTCGGGTGTGTGTGTGGGGG + Intronic
1056754266 9:89372322-89372344 TGTCTGAGGTGTGTGTGGGGGGG + Intronic
1056826732 9:89881084-89881106 GGTGTGTGGTGTGTGTGGGGGGG - Intergenic
1056926802 9:90841886-90841908 AGTCTGTGGTGTGTGTGATGTGG + Intronic
1057022593 9:91711737-91711759 TGTGTGTGGAATGTGTGTGGGGG + Intronic
1057211688 9:93204046-93204068 TGTGTGTGGTGGGGGTGTGGGGG + Intronic
1057386614 9:94610674-94610696 ACTTTTTGGTGTGTGTGTGGGGG - Intronic
1057757471 9:97849399-97849421 TATCTGTGAAGTGTGTATGTGGG - Intergenic
1057910506 9:99016446-99016468 CATCAGTGCTGTGTGTGTGTTGG + Intronic
1057964244 9:99487977-99487999 TACCTGGTGTGTGTGTGTAGGGG - Intergenic
1058117331 9:101099085-101099107 TGGATGTGGTGTGTGTGTGTCGG + Intronic
1058564943 9:106272941-106272963 TAGATGTGGGGTGTGTATGGGGG + Intergenic
1058871109 9:109202427-109202449 TGTGTGTGGTGGGTGTTTGGTGG - Intronic
1059001000 9:110348822-110348844 TTTTTTTGGTGTGTGTGTGGGGG + Intergenic
1059008457 9:110430116-110430138 TTTTTTTGGTGTGTGTGTGTGGG + Intronic
1059225592 9:112670278-112670300 TATCTGTGATGAGTATGTGAGGG + Intergenic
1059248065 9:112865127-112865149 TATGTGGGGTGTATGTGTAGGGG - Intronic
1060149419 9:121278697-121278719 CATCTGGAGTGTGTGGGTGGTGG + Intronic
1060200478 9:121649400-121649422 AGTCTGAGGAGTGTGTGTGGAGG - Intronic
1060478363 9:124001276-124001298 GATTGTTGGTGTGTGTGTGGGGG + Intergenic
1060788896 9:126472210-126472232 AGTCTGAGGTGTGTGTTTGGAGG + Intronic
1061251364 9:129428396-129428418 TGTGTGTGGTGTGTGTGGTGTGG + Intergenic
1061396232 9:130345158-130345180 TGTGTGTGGTGTGTGTATGGTGG + Intronic
1061662967 9:132142584-132142606 TGTGTGTGGTGTGTGTGTGGGGG - Intergenic
1061810479 9:133159800-133159822 TATCTTGTGTGTGTGCGTGGCGG - Intronic
1061988173 9:134142529-134142551 TTTCTGTGCTGTTTGTGGGGAGG + Intronic
1062032626 9:134368631-134368653 GCTGTGTGGTGTGTGTGTGAGGG + Intronic
1062309406 9:135928062-135928084 TTTTTGAAGTGTGTGTGTGGTGG - Intergenic
1062313933 9:135956136-135956158 TGGCTGTGGTGTGTGTGAAGGGG - Intronic
1202799209 9_KI270719v1_random:158957-158979 TATGTGTGATGTGTGTGTATAGG + Intergenic
1202628933 M:510-532 TAGCAGCGGTGTGTGTGTGCTGG - Intergenic
1203445509 Un_GL000219v1:50940-50962 TTTGTGTGGTGTCTGTGTGTGGG - Intergenic
1203377712 Un_KI270442v1:390323-390345 TTTGTGTGGTGTCTGTGTGTGGG - Intergenic
1203620763 Un_KI270749v1:126605-126627 TGTTTGTGGAGAGTGTGTGGTGG + Intergenic
1185488664 X:501723-501745 TTACTGTGGTTTGTGTGTGTTGG - Intergenic
1185886670 X:3789429-3789451 CATTTCTGGTGTGTGTGGGGAGG - Intergenic
1185984769 X:4819558-4819580 TCTCCGTTGTGTGTTTGTGGTGG - Intergenic
1186173799 X:6904423-6904445 TAACTCTTGTTTGTGTGTGGAGG - Intergenic
1186430949 X:9503706-9503728 TAGTTGGGGTGTGTGTGGGGCGG + Intronic
1186526972 X:10257752-10257774 TTCCTTTGGTGTGTGTGTGGGGG - Intergenic
1186902157 X:14068253-14068275 TGTTTGTGGTGTATGTGTTGAGG + Intergenic
1187277716 X:17830726-17830748 CATCTGGGGTGTGTGTGGGGGGG + Intronic
1187535298 X:20136247-20136269 TATGTCTGGTGTGTGTGTGGGGG - Intronic
1188018196 X:25127982-25128004 TAGCAGTGGTGTGAGTGAGGAGG + Intergenic
1188175788 X:26987094-26987116 TATACGGGGTGTGTGTGTGTGGG - Intergenic
1188512219 X:30948779-30948801 TGTCTGTGGGGTGGGGGTGGGGG - Intronic
1189065836 X:37807839-37807861 TGTCTCTGGTGTGTGTCTTGGGG - Intronic
1189447288 X:41092687-41092709 AATTTGGTGTGTGTGTGTGGAGG + Intronic
1189621079 X:42838477-42838499 TTTATGTGGTGTGTTTGTTGGGG - Intergenic
1189719519 X:43901195-43901217 AAACCATGGTGTGTGTGTGGTGG - Intergenic
1190265632 X:48826195-48826217 TGTTGGTGGTGTGTGTGTGTGGG - Intergenic
1190338567 X:49278512-49278534 CATCTGTGATGTGTGGGAGGTGG + Intronic
1190460130 X:50664907-50664929 TCTGTGTGGTGTGTGTGGTGTGG - Intronic
1190618104 X:52259059-52259081 TATCTGTTTTGTATTTGTGGAGG + Intergenic
1192141833 X:68652759-68652781 TGTGTGGGGTGTGTGTGTGGGGG - Intronic
1192183502 X:68930695-68930717 CAGATGTGGTGTGTGTGTGGTGG + Intergenic
1192448819 X:71230128-71230150 TCTTTTTTGTGTGTGTGTGGTGG - Intergenic
1192797893 X:74439688-74439710 TATGTGTGGTGGGGGAGTGGGGG + Intronic
1192891335 X:75394082-75394104 GATCTTTGGTGTGTCTGTGATGG - Intronic
1193158464 X:78200120-78200142 TATCTATAGAGTGTGTGTGTGGG - Intergenic
1193288462 X:79742021-79742043 TATCTGAGGTGTGTCTATGAAGG + Intergenic
1193644257 X:84047563-84047585 TGTCCCTGGTGTGTGTGTGAAGG + Intergenic
1194089710 X:89569553-89569575 ATTCTGGGGGGTGTGTGTGGTGG - Intergenic
1194227431 X:91278801-91278823 TATATGTGTTATTTGTGTGGTGG - Intergenic
1194323528 X:92481300-92481322 TGTGTGGGGTGTGTGTGTGTGGG - Intronic
1194412442 X:93573697-93573719 TATATGTGGTGGGGGTGGGGTGG - Intergenic
1194517703 X:94877319-94877341 GATCTGTGATGTGTATGTGTTGG + Intergenic
1194850416 X:98861833-98861855 TATATGTGTTGCGTGTGTGATGG + Intergenic
1194949986 X:100114192-100114214 TATGTGTGGTGAGGGTGGGGAGG + Intergenic
1195654198 X:107319644-107319666 TGTCTGTAGTGTGTGTGTGGGGG + Intergenic
1195668573 X:107451005-107451027 GGGCTGTGGTGTGTGTGTGCAGG - Intergenic
1196335794 X:114532132-114532154 TGTGTGTTGTCTGTGTGTGGGGG + Intergenic
1196339107 X:114575584-114575606 TTTCTTTTGTGTGTGTGTGGGGG - Intergenic
1196431363 X:115631058-115631080 TATATGTTGTGTGTGTGAGATGG + Intronic
1196609414 X:117694845-117694867 TTGCAGTGGTGTGTGTGTGGGGG - Intergenic
1197121186 X:122895032-122895054 TGTGTGTGTTGTGTGTATGGGGG - Intergenic
1197533913 X:127663831-127663853 GCTCTTTGGTGTGTGTGTGTTGG - Intergenic
1197560057 X:128009936-128009958 TATTTATGATGTGTGTATGGAGG + Intergenic
1197802719 X:130368393-130368415 TTTCTTTTGTGTGTGTGTGGGGG - Intronic
1197820682 X:130538067-130538089 AATCTTTGGTGTGTGGGTGAAGG - Intergenic
1198144799 X:133844286-133844308 TACCGTTTGTGTGTGTGTGGTGG - Intronic
1198231378 X:134692811-134692833 TCTCTGAGTTGTGCGTGTGGGGG - Intronic
1198441736 X:136669968-136669990 TACCTTTTGTATGTGTGTGGTGG + Intronic
1198972109 X:142293429-142293451 AAGCTGAGATGTGTGTGTGGGGG + Intergenic
1199387013 X:147234682-147234704 TATTTTGTGTGTGTGTGTGGGGG - Intergenic
1199664163 X:150083387-150083409 TACATGTAGTGTGTGTGAGGGGG - Intergenic
1200631630 Y:5594466-5594488 TGTGTGGGGTGTGTGTGTGTGGG - Intronic
1201453475 Y:14142249-14142271 AATGTGAGGGGTGTGTGTGGTGG - Intergenic