ID: 1121613158

View in Genome Browser
Species Human (GRCh38)
Location 14:95294777-95294799
Sequence GGCCAATGGGAGGCGCTGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 558
Summary {0: 1, 1: 5, 2: 27, 3: 95, 4: 430}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121613147_1121613158 27 Left 1121613147 14:95294727-95294749 CCACAGGTTGTGTCACTGGGCAC 0: 1
1: 0
2: 1
3: 14
4: 164
Right 1121613158 14:95294777-95294799 GGCCAATGGGAGGCGCTGGCAGG 0: 1
1: 5
2: 27
3: 95
4: 430
1121613150_1121613158 5 Left 1121613150 14:95294749-95294771 CCTGGTCTTCTGGCTACTCACTG 0: 1
1: 0
2: 1
3: 18
4: 218
Right 1121613158 14:95294777-95294799 GGCCAATGGGAGGCGCTGGCAGG 0: 1
1: 5
2: 27
3: 95
4: 430
1121613145_1121613158 30 Left 1121613145 14:95294724-95294746 CCTCCACAGGTTGTGTCACTGGG 0: 1
1: 0
2: 0
3: 15
4: 272
Right 1121613158 14:95294777-95294799 GGCCAATGGGAGGCGCTGGCAGG 0: 1
1: 5
2: 27
3: 95
4: 430

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121613158 Original CRISPR GGCCAATGGGAGGCGCTGGC AGG Intronic
900806269 1:4770085-4770107 GGCCAAAGGGCAGCGCTGGACGG - Intronic
900853355 1:5161566-5161588 GGCCACTGGGAGGGGCTGCAGGG + Intergenic
901157755 1:7151744-7151766 GACCATTGGGAGGCCCTGGAGGG + Intronic
901236765 1:7671433-7671455 GGGCCATGGGAGGCACGGGCAGG - Intronic
901264849 1:7902715-7902737 AGGAAATAGGAGGCGCTGGCCGG - Intergenic
902058724 1:13623782-13623804 GGCCAATGGAAGGCACTGAGAGG + Intergenic
902063365 1:13664025-13664047 GGCCAAGAGGTGGCGCTGGGGGG + Intergenic
902514098 1:16980622-16980644 GGCCAAGGGGCGGCTCCGGCGGG - Exonic
902850038 1:19148058-19148080 GGACACTGGCAGGTGCTGGCAGG + Exonic
903302051 1:22386155-22386177 GGCCACAGGGAGGCGATGGCAGG - Intergenic
903649294 1:24913313-24913335 GGCCCTTGGGAGGGGCAGGCTGG - Intronic
903845927 1:26280002-26280024 GACCAATGGGCGGCGCGGGCAGG - Exonic
904035888 1:27558289-27558311 GGCCAAGGTGAGGTGCTGGGAGG - Exonic
904372414 1:30058222-30058244 AGCCAATGGGAGGTGCTGCCAGG + Intergenic
905017501 1:34787668-34787690 GGTCAGTGGGAGCCACTGGCAGG - Intronic
905223683 1:36466131-36466153 GGCCATTGGGTGGGGCTGGATGG + Exonic
905248256 1:36629486-36629508 GGCCAATGGGAGACATGGGCAGG + Intergenic
907524440 1:55046035-55046057 AGCCAATGGGAGGCACTAGCAGG - Intronic
907571128 1:55485072-55485094 GGCCCATGGGAGGCACTAGTAGG + Intergenic
907705440 1:56828518-56828540 GGCCAATGGAAGGCACTCACAGG - Intergenic
908036677 1:60061993-60062015 GGCCAATGGGTAGCCCTGGCAGG + Intronic
908455938 1:64305275-64305297 TGACACTGGGAGGCACTGGCTGG - Intergenic
909081402 1:71116886-71116908 TGCCAATGGGAGGCACTGTTGGG - Intergenic
909559220 1:76991054-76991076 GGCCAATGAGAAGCACTGGCAGG - Intronic
909871456 1:80744193-80744215 AGCCAATGGGAGGCACCAGCAGG - Intergenic
910892232 1:92030063-92030085 CGCCATTGGGAGGCGGCGGCGGG - Exonic
911166385 1:94728395-94728417 TGCCACTGGGAAGCACTGGCAGG - Intergenic
911531826 1:99052090-99052112 GGGCTTTGGGAGGGGCTGGCAGG + Intergenic
912205161 1:107500617-107500639 GGCCAATGAGAGGCTCTGGCAGG - Intergenic
913167196 1:116199369-116199391 GGCCAATGGGAGGGTGTGGAGGG - Intergenic
913250615 1:116909880-116909902 GCCGGATGGGAGGCGCGGGCGGG + Intergenic
913961253 1:143339579-143339601 AGTCAGTGGGAGGGGCTGGCGGG + Intergenic
914055606 1:144165152-144165174 AGTCAGTGGGAGGGGCTGGCGGG + Intergenic
914123540 1:144801210-144801232 AGTCAGTGGGAGGGGCTGGCGGG - Intergenic
915530742 1:156500863-156500885 GGCCAATGGGAGGCACCTGTGGG + Intergenic
915590526 1:156867917-156867939 GGCCATTGGGAGGCCGAGGCGGG - Intronic
916989908 1:170231800-170231822 GGCCAAAGGGAAGCCCTGGCAGG + Intergenic
918409965 1:184248272-184248294 GGCCAATTCAAGGCCCTGGCAGG - Intergenic
920051130 1:203165846-203165868 CGTCAATGGGAGGTGCAGGCTGG - Exonic
920819051 1:209363235-209363257 GGGGAAGGGGAGGAGCTGGCCGG - Intergenic
922262111 1:223951955-223951977 GGCCGACGGGAGGCACAGGCTGG + Intergenic
922560343 1:226565064-226565086 AGCCAATGGGAGGCACTGGTAGG + Intronic
922909219 1:229201511-229201533 TGCCATTGAGAGGCACTGGCAGG + Intergenic
1062930410 10:1348859-1348881 GGCTCATGGGAGGCACAGGCAGG + Intronic
1063167698 10:3478931-3478953 GGCCAATGAAAGTCACTGGCTGG + Intergenic
1064532367 10:16323298-16323320 AGCCAATGGGAAGCACTGGCAGG - Intergenic
1064635921 10:17366838-17366860 GGCCTATGGGAGTCATTGGCAGG - Intronic
1067029705 10:42871978-42872000 AGTCAGTGGGAGGGGCTGGCGGG + Intergenic
1067462828 10:46470459-46470481 GGTCAATGGGAGGGACTGACAGG - Intergenic
1067624366 10:47914178-47914200 GGTCAATGGGAGGGACTGACAGG + Intergenic
1067749401 10:48960163-48960185 GGCCAGTGGGAGTCCCTGGGAGG - Intronic
1068903484 10:62297190-62297212 GGACAATGGGAGGCACCAGCAGG - Intergenic
1068931408 10:62594193-62594215 AGCCACTGGGTGGCACTGGCAGG + Intronic
1068934428 10:62622215-62622237 GACCAATGGGAGGAACTGGGAGG + Intronic
1069518707 10:69100759-69100781 GGCCAATGGGAGGCAAGGACGGG + Intronic
1069660789 10:70122196-70122218 CTCCAATGGGAGGGGCTGGAGGG + Intronic
1069861084 10:71472192-71472214 AGCCAACAGGAGGCCCTGGCAGG + Intronic
1070377610 10:75848963-75848985 GACCAATGGGAGGCCCTGTCAGG + Intronic
1071246867 10:83774244-83774266 GGCCAATAGGTGGCACTTGCAGG - Intergenic
1071370292 10:84944358-84944380 GGCCAATGAGAGGCACTGGCAGG - Intergenic
1071506315 10:86233893-86233915 GACCAATGGGAGACACAGGCAGG + Intronic
1071880390 10:89890656-89890678 TACCAATGGGAGGCACTGGTGGG + Intergenic
1072966915 10:99981764-99981786 AGCCAATGGATGGCACTGGCAGG + Intronic
1073565067 10:104527972-104527994 GTCCAATGGGAGGGGCTGGCAGG + Intergenic
1073714422 10:106086618-106086640 GGCCAATGGGAGACACTGGCAGG + Intergenic
1074421066 10:113309315-113309337 CGCCAATAGGAGGCATTGGCAGG - Intergenic
1075226597 10:120634905-120634927 GGGAAATGGGAGGCGGAGGCGGG - Intergenic
1075545634 10:123352325-123352347 GGCCAGAGGGAGGCCCAGGCAGG - Intergenic
1076193021 10:128496085-128496107 ACACAATGGGAGGCTCTGGCTGG - Intergenic
1076227775 10:128794090-128794112 GGGCCATGGGAGGAGCTGGCAGG - Intergenic
1076321916 10:129589357-129589379 GGCCCAAGTGAGGCCCTGGCAGG - Intronic
1076599552 10:131647991-131648013 GGGAAATGGGAGGCGCTGGCGGG - Intergenic
1076745491 10:132510631-132510653 GGCCACTGGGAGGGGCTTGGAGG - Intergenic
1077853612 11:6099800-6099822 GGCCAGGGGGAGGCACTGGTGGG - Intergenic
1077951455 11:6962305-6962327 AGCCAATGGGAGTCCCTGGCAGG - Intronic
1078861227 11:15249112-15249134 AGCCAATGGGAGGCACTGGAAGG - Intergenic
1078876374 11:15403005-15403027 GGCCAGTGGGTGGCACTTGCAGG + Intergenic
1079281895 11:19095157-19095179 GGCCCATGGAAGGCTCTGGAGGG - Intergenic
1079321297 11:19453850-19453872 GGCCAATGGATGGCTCTGGATGG - Intronic
1080285707 11:30608675-30608697 GGCCAATGGGAGCCACTGGCTGG + Intergenic
1081605724 11:44526070-44526092 GGCCAATGGGAAGAACTGGATGG - Intergenic
1081678118 11:44982847-44982869 AGCCAATGGAAGGCCCCGGCAGG + Intergenic
1081783872 11:45732806-45732828 GGCCACTGGGAGACACAGGCAGG - Intergenic
1082260047 11:50071693-50071715 GGCCAATGGGAGGCAGGAGCTGG + Intergenic
1082260449 11:50073452-50073474 GGCCAATGGGAGGCAGGAGCTGG + Intergenic
1082792852 11:57359280-57359302 GGTCAATGGGCGGCACTGGCAGG - Intronic
1082793768 11:57365444-57365466 AGCCAATGGAAGGCGCTGAGAGG - Intronic
1082961657 11:58923699-58923721 AGCCAAGGGGAGGGGCAGGCTGG - Intronic
1083578773 11:63811952-63811974 AGCCAATGGGAGGCAGTGGCAGG - Intergenic
1083752435 11:64767873-64767895 TGCCACTAGGAGGCGCAGGCAGG - Intronic
1083756325 11:64793572-64793594 GGCCACTGGGTGGAGGTGGCAGG - Intronic
1084192709 11:67506034-67506056 TGTCAAGGGGAGGGGCTGGCGGG - Intronic
1085006224 11:73093198-73093220 GGACAATGGGAAGCTCTGACTGG + Intronic
1085204826 11:74725235-74725257 GCCCTTTGGGAGGCCCTGGCGGG - Intronic
1085752582 11:79174613-79174635 AGCCAATGGGAGACTCTGGCAGG + Intronic
1085794091 11:79520709-79520731 GGCCAGTGGAGGGCACTGGCTGG + Intergenic
1085837707 11:79974359-79974381 AGCCAATGGAAGGCACTGGGAGG - Intergenic
1086154410 11:83649728-83649750 AGCCAATGGGAGGCACTAACAGG + Intronic
1088158713 11:106842033-106842055 GGCCAATGGTAAACGATGGCAGG + Intronic
1088262873 11:107960884-107960906 AGCCAATGGGAGGCGCTGGCTGG - Intronic
1088604190 11:111512736-111512758 GGCCAGCGGGCGGCGCTGCCGGG - Intergenic
1089207112 11:116773103-116773125 GGCCACCGGGACGCGCTCGCAGG + Intergenic
1089411540 11:118247131-118247153 GGCCAACGGGAGGCATTGGCAGG - Intronic
1089842989 11:121434954-121434976 GGCCAATTGGAGGCACTGCGAGG - Intergenic
1090312191 11:125750815-125750837 TGCCAATAGGAGGTGCTGGAGGG - Intergenic
1090358707 11:126158097-126158119 GGCCAAAGGAGGGCTCTGGCCGG - Intergenic
1091206187 11:133822940-133822962 GGCCATTGGGAGGCATTGTCTGG - Intergenic
1091309664 11:134563340-134563362 GGGCAGTGGGAGGGGATGGCAGG + Intergenic
1092168012 12:6354938-6354960 GGCCAGTAGGAGGGGCTGGCAGG - Intronic
1093747497 12:22759850-22759872 GGTCAATGGGAGTCGCCAGCAGG - Intergenic
1094280330 12:28730362-28730384 GGCCAATGAGAGCCACTGGCAGG + Intergenic
1094598256 12:31884921-31884943 AGCCAATGGAAAGTGCTGGCAGG - Intergenic
1095659753 12:44717817-44717839 CACCAATGGGAGACACTGGCAGG - Intronic
1096652764 12:53069984-53070006 AGGCAAAGGGAGGGGCTGGCCGG - Intronic
1096695334 12:53345045-53345067 GGGCAGCGGGGGGCGCTGGCTGG - Intronic
1096876986 12:54637085-54637107 GGCCAATGGGAGACACAGGTGGG + Intergenic
1099150703 12:79109210-79109232 GGCCAGTTGGAGGCTCTGCCAGG + Intronic
1100774137 12:97955847-97955869 GGCCAATGGGAGGCACTGGTGGG - Intergenic
1101817125 12:108153773-108153795 GGCCAACGGGAGGCCCTGGCAGG - Intronic
1101834844 12:108287997-108288019 GGCAAAAGGGAGGTGATGGCAGG + Intergenic
1102196485 12:111029044-111029066 GGCTAGTGGGAGGCCCTGGTAGG - Intergenic
1102422509 12:112815111-112815133 GTCCAATGGGAGGCACCAGCAGG - Intronic
1102732552 12:115125769-115125791 GACCAATGGGAGACACTTGCAGG + Intergenic
1102743985 12:115233503-115233525 GGGCAATGGGAGGCACTGGCAGG - Intergenic
1102804691 12:115769342-115769364 GGCCAATAGGAGGCACCAGCAGG - Intergenic
1103229786 12:119319793-119319815 AGTCAATAGGAGGCACTGGCAGG + Intergenic
1103493869 12:121345638-121345660 GGCCAATGGGAGGCACTGGCAGG - Intronic
1104414798 12:128589289-128589311 GGGCAAGGGGAGGCCCTTGCAGG - Intronic
1104536727 12:129624654-129624676 AGCCCATGGGAGGCACTGGCAGG - Intronic
1104549129 12:129739750-129739772 AGGCAGTGGGAGGCGCTGGCAGG + Intronic
1104772411 12:131371769-131371791 GGCCAATGGGAGGCCTCAGCAGG - Intergenic
1104860474 12:131920909-131920931 GGCCAAGGGGAGACACTGCCTGG - Intronic
1105931656 13:25058147-25058169 GGCCAGTGGGCAGCCCTGGCTGG - Intergenic
1107873061 13:44764631-44764653 GGCCCCAGGGATGCGCTGGCAGG - Intergenic
1109688144 13:65847520-65847542 GGCCAATGGGAGGCCTTGGTGGG + Intergenic
1112467172 13:99654382-99654404 GGCAAAGAGGAGGGGCTGGCTGG + Intronic
1112716765 13:102195678-102195700 GGCCAATTGGAGGCTGAGGCTGG + Intronic
1113545472 13:111145703-111145725 AGCCAATAGGAGGCCCTGGCAGG - Intronic
1113788419 13:113015045-113015067 GGCCACTGGGAGGAGGTGGGTGG + Intronic
1115511913 14:34146316-34146338 GGCCCATCTGAGGGGCTGGCAGG + Intronic
1115859240 14:37666169-37666191 GGCCAATGGAGGGTGCTGGAAGG - Intronic
1116632155 14:47349902-47349924 AGCCAGTGAGAGGCACTGGCAGG + Intronic
1116991949 14:51286287-51286309 GGCCAATGGGAAGCACTAGCAGG + Intergenic
1119194734 14:72709012-72709034 GGCTGATGGGAGGAGCAGGCTGG - Intronic
1121613158 14:95294777-95294799 GGCCAATGGGAGGCGCTGGCAGG + Intronic
1121825711 14:97008160-97008182 CGCCAATGGGAGGCACCAGCAGG - Intergenic
1121994694 14:98593065-98593087 GCCCCAGGGGAGCCGCTGGCAGG - Intergenic
1122052922 14:99072532-99072554 GGCACATCGGAGGCCCTGGCAGG - Intergenic
1122680154 14:103454088-103454110 GGCCAATGAGGGCCACTGGCTGG - Intronic
1122719856 14:103715996-103716018 GGCGGGTCGGAGGCGCTGGCCGG - Intronic
1122897812 14:104769085-104769107 GGGAGATGGGAGGCCCTGGCTGG - Intergenic
1122909589 14:104820879-104820901 CGCCAGTGGGAGCTGCTGGCAGG - Intergenic
1123629481 15:22251242-22251264 GGCCAAGTGGAGGCGGAGGCAGG - Intergenic
1124176091 15:27425356-27425378 GGCCACTGGGAGGCCGAGGCAGG + Intronic
1124226707 15:27901360-27901382 GGCCAATGGGAGACACTGGCAGG + Intronic
1124817963 15:33015635-33015657 GGCCAGTGAGAGGCACAGGCCGG - Intronic
1124831203 15:33151181-33151203 GGCCAATAGGAGGTAATGGCTGG + Intronic
1125491158 15:40149550-40149572 GGCCAGTGGGGGTCCCTGGCAGG + Intergenic
1125759977 15:42089647-42089669 GGCCACAGGGAGGTGATGGCTGG + Intronic
1126117557 15:45222375-45222397 AGCCAATGGGAAGCACTGGCAGG - Intergenic
1127148589 15:56050548-56050570 GGCCACTGGGAGATGCTAGCAGG + Intergenic
1127456391 15:59159449-59159471 GGCCAACAGGAGGCACTGGAAGG + Intronic
1128111331 15:65077944-65077966 GGCCAGTGGACGGCGCTGCCCGG + Exonic
1129595358 15:76959605-76959627 GGCCAGTGGGAGGCACAGACAGG - Intergenic
1129744374 15:78007914-78007936 GGCCAGCGGGAGGTGCTGGCAGG - Intronic
1129776141 15:78237664-78237686 GGCCAATGCCAGGTGGTGGCAGG + Intronic
1130169353 15:81495844-81495866 AGCCTATGGGAGGCACTGACAGG - Intergenic
1130883950 15:88077993-88078015 AACCAATGGGAGCTGCTGGCTGG - Intronic
1131232597 15:90670564-90670586 GCTCAATGGGAGGGGCTGGAGGG + Intergenic
1131237988 15:90713622-90713644 GGCAAATGGGAGCTGCTGGAAGG + Intergenic
1131342881 15:91619336-91619358 GACCAATGGGAGGCTCTAGCAGG + Intergenic
1132385494 15:101397482-101397504 GGAGAATGGGAGGGGGTGGCAGG - Intronic
1132424127 15:101699663-101699685 GGCCAATGCGAGGCAATGGTAGG - Intronic
1132731502 16:1364697-1364719 GGCCACTGAGAGGCTGTGGCCGG + Intronic
1132840848 16:1977916-1977938 GGCCACTGAGGGCCGCTGGCTGG - Intronic
1134009873 16:10843917-10843939 GGCCAATGGGAGCCTGTGGGTGG - Intergenic
1135534666 16:23284024-23284046 GGCCAAAAAGAGGCACTGGCAGG - Intronic
1135740147 16:24968203-24968225 GGCCTATAGGAGGTGCTGGCAGG + Intronic
1135798947 16:25474677-25474699 GGCCAATGGGACGCACCAGCAGG + Intergenic
1135881706 16:26263829-26263851 GGCCAATGGAAGGTACTGGCAGG - Intergenic
1135884259 16:26291125-26291147 AGAAAATGGGAGGCCCTGGCCGG + Intergenic
1136561597 16:31042340-31042362 GGCCACCGGGAGGCGCAGTCGGG - Intronic
1136561604 16:31042361-31042383 GGCCACCGGGAGGCGCTGCGGGG - Intronic
1136845283 16:33571860-33571882 GTCCACTGGGAGACGCAGGCAGG - Intergenic
1136993937 16:35174570-35174592 GGCCAATGGTAGGCGAAGGTGGG - Intergenic
1138311468 16:56027119-56027141 GGCCAATGGGAAGCCCCGGTGGG - Intergenic
1139111894 16:63902195-63902217 GGACAATAGGAAGCCCTGGCAGG - Intergenic
1139545099 16:67646320-67646342 GGCAAATTCGAGGGGCTGGCAGG + Intronic
1140274507 16:73496773-73496795 GCCAAATGGGAGGCACTGGGAGG + Intergenic
1140416022 16:74774524-74774546 GGCCAACGCGCGCCGCTGGCTGG - Exonic
1140891823 16:79291290-79291312 GGACAGTGGGAGGTGCTGGTGGG + Intergenic
1141275583 16:82584939-82584961 TGGCAAAGGGAGGTGCTGGCAGG + Intergenic
1141513905 16:84530350-84530372 GGCCAGTGGGAGGCACTAGCAGG + Intronic
1142170423 16:88619168-88619190 GTCCAATGGGAGGCTGAGGCAGG + Intronic
1142174050 16:88636871-88636893 GGCCAAGAGGAGGTGCTGGAGGG + Intergenic
1142203398 16:88771651-88771673 GGCCATAGGGAGGTGCTGGGTGG + Intronic
1142228086 16:88887170-88887192 GGGAATGGGGAGGCGCTGGCAGG - Intronic
1142329590 16:89442855-89442877 GGCCCGTGGGAGGTGGTGGCCGG - Intronic
1203106991 16_KI270728v1_random:1420513-1420535 GTCCACTGGGAGACGCAGGCAGG - Intergenic
1203155451 16_KI270728v1_random:1872158-1872180 GTCCACTGGGAGACGCAGGCAGG - Intergenic
1142755060 17:2011533-2011555 GGGCAAGAGGAGGAGCTGGCGGG + Intronic
1142863316 17:2776523-2776545 GGGCACCGGGAGGCGGTGGCAGG - Intergenic
1142876373 17:2853875-2853897 GGCCCATGCGAGGCGGAGGCCGG + Intronic
1143023292 17:3927658-3927680 GGCCAATGGGTGGGGGTGGGGGG - Intronic
1143461653 17:7108186-7108208 GGCCCATCGGAGGGGCAGGCAGG - Intronic
1144656786 17:17042293-17042315 GGCCAATGGCAGTCGGGGGCGGG - Intergenic
1145237427 17:21218332-21218354 AGCCAGTGGGAGGCACTGGTGGG - Intergenic
1146966488 17:37035647-37035669 GACCAATGGGAGGCTGAGGCAGG - Intronic
1147219589 17:38920518-38920540 GGCCAATGGCAGGGCCTGGTTGG - Exonic
1147247736 17:39133152-39133174 GGAGAATGGGTGGCCCTGGCTGG - Intronic
1148140273 17:45323226-45323248 GGCCAGTAAGAGGCTCTGGCAGG - Intergenic
1148673750 17:49432899-49432921 AGCCAATGGGAGGCCCTGGCAGG + Intronic
1148779082 17:50111627-50111649 GGCAGATGGGAGGAGCTGGAGGG + Exonic
1149008110 17:51826705-51826727 GGCCAATGAGGGGCCCTGGCAGG + Intronic
1149019842 17:51950417-51950439 GGCCAATAGGAGGCACTCGCAGG + Intronic
1149336787 17:55643834-55643856 GGCCAATGGGAAGCCCTGGAAGG - Intergenic
1149404952 17:56338971-56338993 ACCCAATGGGAGGCACTGGCTGG - Intronic
1150139720 17:62717555-62717577 GGCCCATGGGAGGCCCCGGCAGG + Intronic
1151354610 17:73550978-73551000 GGCCAGTGGGAAGCACTGACAGG - Intronic
1151433343 17:74079738-74079760 GGCCTATCAGAGGCACTGGCAGG + Intergenic
1151482734 17:74379919-74379941 GGCCAGCAGGAGGGGCTGGCAGG - Intergenic
1151678474 17:75611885-75611907 GGCCATCGGGACGCCCTGGCTGG + Intergenic
1151774459 17:76189957-76189979 TGCCAGTGGGAGGTGCTGGAAGG - Intronic
1151815640 17:76470211-76470233 GGACAATGGGAGGTGCTGTGGGG + Intergenic
1152376674 17:79922217-79922239 GGCTGGTGGGAGGGGCTGGCGGG - Intergenic
1152984827 18:311978-312000 GGACAATGAGAGGCACTGGCAGG - Intergenic
1153095126 18:1392271-1392293 GGCCAATGGGAGGCACTGGCAGG - Intergenic
1155286393 18:24293421-24293443 AGCAAATGGGAGGCTCTGTCGGG - Intronic
1155360817 18:24999606-24999628 GGACAATGCCAGGTGCTGGCAGG + Intergenic
1155422710 18:25672616-25672638 AGCCAATGATAGGCACTGGCAGG + Intergenic
1155450767 18:25960472-25960494 GGCCAAGGGTGGACGCTGGCTGG - Intergenic
1157157729 18:45284341-45284363 GGCCAATGGGAGGCACTGTTGGG + Intronic
1157649030 18:49308695-49308717 TGACAATGGGAGACACTGGCGGG + Intronic
1158253850 18:55522191-55522213 TACCAATAGGAGGCGCTGGAGGG - Intronic
1158278668 18:55796650-55796672 CACCAATGGGGGGCGCTAGCTGG - Intergenic
1158547121 18:58405828-58405850 GCCCCGTGGGAGGCTCTGGCAGG - Intergenic
1160011394 18:75109290-75109312 GGCCCATGGGAGGAGCTGGCTGG - Intergenic
1160763494 19:797301-797323 GGCCAGTGGGAGGTGCTGGCGGG + Exonic
1161250344 19:3276548-3276570 GGCCAATAGGAGGCTGGGGCTGG + Intronic
1161405379 19:4088500-4088522 TGCCAATGGCAGGGGGTGGCCGG + Intergenic
1161585682 19:5104118-5104140 GGCCAATGAGTCCCGCTGGCAGG + Intronic
1161595989 19:5151243-5151265 GGCCTCTGAGAGGAGCTGGCTGG - Intronic
1161795047 19:6381539-6381561 GCCCAAGGGTAGGCGATGGCTGG - Exonic
1161932306 19:7349130-7349152 GGCCCAAGGGAACCGCTGGCTGG - Exonic
1161937501 19:7381109-7381131 GGGCAATGGTGGGAGCTGGCAGG + Intronic
1162463879 19:10829608-10829630 GGCAGATGGGAGGCTCTGGAGGG + Intronic
1162824612 19:13243987-13244009 GGGCCATGGGAGGCTCTGGCAGG + Intronic
1163108102 19:15139194-15139216 GGCCAATTGGAGGCATTGTCAGG - Intergenic
1163248463 19:16111685-16111707 GGCCAATGGGAGGTGCGCTCGGG + Exonic
1163649657 19:18509816-18509838 GCCCACTGGGGGGCACTGGCTGG - Intronic
1164596599 19:29534285-29534307 GGCCAAAGGGAGGCCCAGACAGG - Intronic
1164704021 19:30305793-30305815 GGCCCCTGGTAGGCACTGGCTGG + Intronic
1165077319 19:33287083-33287105 GGCCAATGGGCGGCACCAGCAGG - Intergenic
1165867368 19:38946957-38946979 AGCCAATGGGATGCTCCGGCAGG + Intronic
1165941085 19:39415119-39415141 GGCGGATGGGAGGCCCTGGAAGG - Exonic
1166317819 19:41998677-41998699 GTCCACTGGGGGGCGCAGGCGGG + Exonic
1166322685 19:42028404-42028426 TGCCAATAGGGGGCGCTAGCGGG + Intronic
1166378676 19:42343478-42343500 GACCACTGGGAGGCGCTGCTCGG - Exonic
1166391182 19:42409749-42409771 GGACACAGGGAGGAGCTGGCTGG + Intronic
1167037813 19:47004327-47004349 GGCCAATGCGCGGCGCGCGCGGG + Exonic
1167189422 19:47974162-47974184 GACCAATGGGATGCACTGGCAGG + Intronic
1167200483 19:48061880-48061902 GGCAATGGGGAGGTGCTGGCTGG - Intronic
1167790724 19:51677950-51677972 TGCCAGTGGGAGGCACTGTCCGG + Intergenic
1202695089 1_KI270712v1_random:117829-117851 AGTCAGTGGGAGGGGCTGGCGGG + Intergenic
925919835 2:8631205-8631227 GGCCAAGGGGAAGGGCTGGGAGG - Intergenic
925979711 2:9166907-9166929 GGCCAGTGGGAAGCTCTGGGAGG - Intergenic
925988800 2:9237032-9237054 GGCCAAGGGGAGGGGAAGGCAGG + Intronic
926127688 2:10282043-10282065 GGGCACTGGCAGGTGCTGGCAGG + Intergenic
926529582 2:14027083-14027105 GGCCAATGGGATGTACTGGTGGG + Intergenic
927065110 2:19463240-19463262 GGCCAATGGGAGGCACAGTAAGG - Intergenic
928136738 2:28693524-28693546 GACCAATGGGAAGTGCTGGGGGG - Intergenic
928341083 2:30443759-30443781 AGCCAATGGGAGGCCCTGGCTGG - Intergenic
929242546 2:39666647-39666669 GGGGAATGGGAGGCGAAGGCAGG - Intronic
931183899 2:59931000-59931022 GGCCAATGGAATATGCTGGCAGG - Intergenic
932274622 2:70442817-70442839 AGCCAGTGGGAGGCACTGGCAGG - Intergenic
932618645 2:73252440-73252462 GGCTAAGGGGAGGAGTTGGCGGG + Intronic
932655900 2:73610987-73611009 TGGGAATGGGAGGAGCTGGCTGG - Intergenic
932788718 2:74633113-74633135 GGTCAATGGGAGGCACCAGCAGG + Intronic
932893131 2:75613067-75613089 GGCCAATGGGAGGTGCTGGTGGG - Intergenic
933311617 2:80668091-80668113 GGCCAGTGGGAAGCACTGGTAGG - Intergenic
933589345 2:84214645-84214667 GGCCAGTGGGAGGTGCTGGCTGG - Intergenic
934276259 2:91574878-91574900 AGTCAGTGGGAGGGGCTGGCGGG + Intergenic
934518573 2:95005065-95005087 GGCCAGTGGTGGGCTCTGGCAGG - Intergenic
934895554 2:98116750-98116772 GGCAGATGGGAGGCCCAGGCAGG - Intronic
935118474 2:100158990-100159012 GGCCAGTGGGAGTCAGTGGCAGG - Intergenic
935371397 2:102350689-102350711 GGCCAATGGGAGGCACTGGCAGG + Intronic
936049262 2:109210934-109210956 GCCCACTGGGAGGCTCTGACAGG - Intronic
936675482 2:114709153-114709175 GACCAAAGGGAGGCATTGGCAGG + Intronic
936814095 2:116438192-116438214 AGCCAATGGGAGACACTGGCAGG - Intergenic
937158139 2:119735816-119735838 GGCCGCTGGGAGGCCTTGGCGGG - Intergenic
937245414 2:120489238-120489260 AGCCAATGGGGAGTGCTGGCAGG - Intergenic
938263728 2:129912016-129912038 GGCCGGTGGGAGGCACAGGCAGG - Intergenic
938368797 2:130756161-130756183 GGCCAGCGGGAGGGGCGGGCCGG - Intronic
938589176 2:132720598-132720620 GGCCAATGGGAGTGGGTGGTGGG + Intronic
938991325 2:136632839-136632861 GACCAATGGGGGGCAGTGGCTGG - Intergenic
944295160 2:198053322-198053344 AGCCAATGAGAGGCACTGGCAGG + Intronic
944309607 2:198218734-198218756 GGCCAATGTGAGGCACTTGCAGG - Intronic
944394886 2:199255432-199255454 GGCCAATAGGAGAAACTGGCAGG + Intergenic
945225728 2:207529919-207529941 CGGCACTGGGCGGCGCTGGCTGG + Exonic
945969444 2:216221548-216221570 GGCCACTGGCAGGCGCATGCAGG + Intergenic
946042975 2:216798371-216798393 GGCCAGTGGGAGGCACTATCTGG - Intergenic
946360944 2:219219011-219219033 GGCCAATGGGAGCCGTGGGTAGG - Intronic
947565953 2:231193256-231193278 GGCAAATGGGATGCTTTGGCAGG + Intergenic
947702316 2:232244651-232244673 GGCCAAAGGAAGGAGCTGGAAGG + Intronic
948087726 2:235265531-235265553 GGCCAGCTGGAGGCCCTGGCAGG + Intergenic
1168732999 20:103614-103636 GGGCCATGGGAGGGGCTGGCAGG - Intergenic
1168809853 20:698033-698055 GGGCACTGGGAGGCTCTGGAGGG + Intergenic
1169547747 20:6668021-6668043 AGCTAATGCGAGGTGCTGGCAGG + Intergenic
1169928508 20:10807757-10807779 GGCCAATGGGAAGCATTGGAAGG - Intergenic
1169928627 20:10808472-10808494 GGCCAATGGGAAGCATTGGAAGG + Intergenic
1170326288 20:15157718-15157740 AGCCAATGGTGGGCACTGGCAGG + Intronic
1170557350 20:17525508-17525530 GGCAAATGGGTGGGGCAGGCTGG + Intronic
1170559137 20:17540748-17540770 GGCAAATGGGAGTCACTGTCAGG + Intronic
1170598837 20:17825395-17825417 GGCCAATGGGGGGCCCGGGCAGG - Intergenic
1170769443 20:19319220-19319242 GGACACTGGTAGGGGCTGGCTGG + Intronic
1171134751 20:22686271-22686293 AGCCAATGGGAGGCACTGGCCGG + Intergenic
1171167016 20:22980987-22981009 AGCCAATGAGGGGCACTGGCAGG + Intergenic
1172123509 20:32612091-32612113 GGCCAATGGGAGATGCTGGGAGG - Intergenic
1172598071 20:36164144-36164166 GGCCAATAGAAGACACTGGCAGG - Intronic
1172707612 20:36893904-36893926 GGTCAGTGGGAGGCTCTGGTGGG + Exonic
1172814075 20:37672534-37672556 GGCCAATGGGAGGCGCCGGTGGG + Intergenic
1172947435 20:38700341-38700363 AGCCAATGGGAGGAGCAGCCTGG - Intergenic
1172958804 20:38782403-38782425 GGCCAATAGGGAGCCCTGGCAGG - Intergenic
1173183034 20:40818954-40818976 GGCCAATGGGAGGTATTGGCAGG - Intergenic
1173226715 20:41166431-41166453 GGGCCATGGGTGGTGCTGGCCGG + Intronic
1174355983 20:49998180-49998202 GAGCCATGGGAGGGGCTGGCAGG + Intergenic
1174383513 20:50172483-50172505 GGCCAACGGGAGGCCCCGGTCGG + Intergenic
1174485651 20:50859571-50859593 GGCCAGTGGGAGGCTCAGCCTGG + Intronic
1175069826 20:56323997-56324019 GGCCAATGGGAGGCAGCAGCTGG + Intergenic
1175238050 20:57526501-57526523 GGGCACTGGGAGACGCTGGCGGG + Intergenic
1175429762 20:58892422-58892444 CGCCAAAGGGAGGCTTTGGCGGG + Intronic
1175517245 20:59577457-59577479 GGCCGCGGGGAGGCGCCGGCGGG - Intergenic
1176259485 20:64172008-64172030 GGCCAGTAGGAGGGGCTGGCAGG - Intronic
1177197393 21:17917665-17917687 GGCCAATAGAAGGCACTGCCAGG - Intronic
1179722085 21:43321710-43321732 GCCCCCTGGGAGGCGCTTGCTGG + Intergenic
1180179218 21:46110605-46110627 GGACTAGGGGAGGCGCTGCCAGG - Intronic
1180187354 21:46146145-46146167 GCCCAAAGGGAGGCGCTGGGAGG + Intronic
1180253369 21:46605168-46605190 AGCCAATGGGAGCCGAAGGCGGG + Exonic
1180908248 22:19431114-19431136 GACCAGTGGAAGGCACTGGCTGG + Intronic
1181163954 22:20973686-20973708 GGACACTGGGAGGAGCTGCCAGG + Intronic
1181850937 22:25749533-25749555 GGCCAATGGAAGGCTCTGGGAGG - Intronic
1182020937 22:27080992-27081014 AGCCAATGGGAGGTGATGTCAGG + Intergenic
1182317535 22:29457992-29458014 AGCCAATGGGAGGCACTGAAGGG + Intergenic
1182988053 22:34739717-34739739 GGCCAGTGGGAGACAATGGCAGG - Intergenic
1183132804 22:35855776-35855798 GCCCACTGGGAGGCTCAGGCAGG + Intronic
1183208251 22:36433809-36433831 GGCCAGCGGGAGGGGCGGGCTGG + Intergenic
1183586541 22:38756079-38756101 GGCCAATGGGTGGCGGCGGTGGG - Intronic
1183796593 22:40123511-40123533 AGCCAGTGGGAGGCACTGACTGG - Intronic
1183964892 22:41435708-41435730 GGCCACAGGGAGTTGCTGGCTGG - Exonic
1184689130 22:46109546-46109568 GGCCAACGGGGGGAGCTTGCTGG - Intronic
1184696384 22:46141444-46141466 GTCCACTGGGAGACGCAGGCAGG + Intergenic
1184851368 22:47123176-47123198 GGCCAAAGGGAAGGGCTGGGTGG - Intronic
1185016551 22:48346518-48346540 AGCCATGGGGAGACGCTGGCTGG + Intergenic
1185118643 22:48952511-48952533 GGCCATCGGGAGCGGCTGGCAGG - Intergenic
1185366702 22:50440125-50440147 GGGCAGTGGGAGGAGGTGGCCGG + Intronic
949546245 3:5075215-5075237 GGCCAATGGTAGGCACCAGCAGG + Intergenic
950189244 3:10965294-10965316 AGCTGATGGGAGGCCCTGGCAGG + Intergenic
950197708 3:11020965-11020987 GACCATTGGGAGGAGCTGGCAGG - Intronic
950359754 3:12441808-12441830 GGCCAATGGGAGACTTTGGCAGG - Intergenic
950524479 3:13516029-13516051 GGCCATTGGGAGGGTCGGGCGGG + Intergenic
950574508 3:13823789-13823811 GGCCTGTGGAAGGCACTGGCAGG + Intronic
951259876 3:20495191-20495213 GGCCCATGGGAGGTTCTGCCAGG + Intergenic
952234188 3:31462191-31462213 TACCAATGGGAGGCTCTGGCAGG + Intergenic
952305057 3:32138151-32138173 AGCCAATGGGAGGCATTGTCAGG - Intronic
953216349 3:40922407-40922429 TGGCTATGGGAGGTGCTGGCAGG - Intergenic
953548828 3:43884822-43884844 GGCCCATGGCAGGTGCTGGCAGG + Intergenic
953559186 3:43971646-43971668 GGCCAATGGTGGGGCCTGGCTGG + Intergenic
953614680 3:44478905-44478927 GGCCAATGGGAAGCCCTGGCAGG - Intergenic
953871385 3:46630133-46630155 GGCCACTGGGAGGCGCCGGAGGG - Intergenic
954104017 3:48399369-48399391 GGCCAACGGGACGGGCTGGCAGG + Intronic
954678882 3:52330849-52330871 GGCCAATGGGAGGCTGGGACAGG - Intronic
954707877 3:52490665-52490687 GGACAGAGGGAGGCGGTGGCAGG - Intronic
955878760 3:63521901-63521923 GGCCAGTCGGAAGCACTGGCAGG - Intronic
957255043 3:77825743-77825765 GAGCACTGGGAGGGGCTGGCAGG + Intergenic
960708477 3:120504458-120504480 GGCCAGTGGGAGGGGCTGGCAGG + Intergenic
960998208 3:123353193-123353215 GGGAAATGGCAGGCACTGGCCGG - Intronic
961311620 3:126005617-126005639 GGCCAATGGGAGACACTGGCAGG + Intergenic
961358079 3:126351489-126351511 GCCCAAAGGGAGCCGCTGCCTGG + Intronic
961664629 3:128487993-128488015 AGCCAATGGGAGGCGGAGGCTGG - Intronic
961740002 3:129027295-129027317 GGCCATGGGGAGGCGCTGCAGGG + Intronic
961831575 3:129625644-129625666 AACCACTGGGAGGCGCTGGGTGG + Intergenic
962613701 3:137103532-137103554 GGGCAATGGGAGCCCCTGGAGGG + Intergenic
964605170 3:158553145-158553167 GGCCAACGGGAGGGACTGTCAGG + Intergenic
965610201 3:170535614-170535636 GGTCAATGGGAGGCACCAGCAGG + Intronic
967691334 3:192477255-192477277 GTCCAGTGGGAAGCGCTGGCAGG - Intronic
968671829 4:1856164-1856186 GCCCAATGGGAGCCGCGGCCTGG - Exonic
968877966 4:3284123-3284145 GGCCAATGGGAAGCGCCAGCAGG + Intergenic
970145902 4:13035459-13035481 GGCCAATGGGAGGCCCTTTCAGG - Intergenic
970539759 4:17065647-17065669 AGCCAATGGGAGACACTGGGGGG - Intergenic
970693298 4:18644660-18644682 AGCCAATGGGAGGCACTGTCAGG - Intergenic
971329577 4:25671534-25671556 GGGGAATGGGAGGCAATGGCGGG - Intronic
971526121 4:27620943-27620965 GGGCCCTGGGAGGGGCTGGCAGG - Intergenic
972222028 4:36966758-36966780 GGCCACTGGGAAGCTCTAGCTGG - Intergenic
972385644 4:38563032-38563054 GGCTAATGGGAGGCTCTGGTGGG - Intergenic
972397896 4:38672939-38672961 GGCCAATGGGAGGCGGGGAGGGG + Intronic
973176459 4:47212245-47212267 GGCCAATGGGAGACCCAGGCAGG - Intronic
973250108 4:48051367-48051389 GGCCAATTGGAGGGGGTGGTTGG + Intergenic
973894165 4:55395882-55395904 GGCCAATGGGAGGCCGTCGCGGG + Intergenic
974728237 4:65824963-65824985 TGCCAATGGGAGGCACTAGTAGG - Intergenic
976097051 4:81519261-81519283 GGTCATTGGGAGGCACTGGCAGG - Intronic
976287848 4:83387186-83387208 GGCCAGTGGGAGGCACTGGCGGG - Intergenic
976334556 4:83870522-83870544 GGCCAATGGGAGGTGCTGGTAGG + Intergenic
976599895 4:86928422-86928444 GGCCAATGGAAGGCACTGGGAGG - Intronic
977176767 4:93828628-93828650 AGCCAATGGAGGGCGCGGGCAGG - Intergenic
977586848 4:98783730-98783752 GGGCAATGGGAGACCCTGTCAGG - Intergenic
979259927 4:118636266-118636288 GGCCACTGGGAGCCGCTGCATGG - Intergenic
979328457 4:119404360-119404382 GGCCACTGGGAGCCGCTGCATGG + Intergenic
982422346 4:155211952-155211974 GGTCGGTGGGAGGCACTGGCAGG - Intronic
984873006 4:184343953-184343975 TGCCAATGGGAGACACTGGTGGG - Intergenic
987418824 5:17693907-17693929 TGCCAATGGGAGGTGTTGGAGGG + Intergenic
988510917 5:31864077-31864099 AGCCAATGGGAGGCACTGGCAGG + Intronic
988670036 5:33371439-33371461 AGCCAATGGGAGGCACTGGATGG + Intergenic
988732449 5:33986629-33986651 GGCTAATGGGAGACACTGGTAGG + Intronic
990147264 5:52776131-52776153 GGCCAGTGGGAGCCAGTGGCAGG + Intergenic
991042264 5:62188254-62188276 GGCCAATGGGAGGCCAAGGCAGG - Intergenic
991573413 5:68078703-68078725 GGCCTCTGGGAGGCGGTGGTGGG + Intergenic
992344209 5:75859900-75859922 GGCAAATGGGAGGCGTAGGAAGG - Intergenic
992489852 5:77231919-77231941 GACCAGTGGGAGGCACTGGCAGG - Intronic
992662121 5:78972119-78972141 AGCCAATGGGGAGCCCTGGCAGG + Intronic
993996487 5:94729537-94729559 GGCCAATGGGAGATACTGGAAGG - Intronic
994710104 5:103256180-103256202 GGCCAATGCAAGGCACTGGAAGG + Intergenic
996911836 5:128665507-128665529 GGCCAATGGGAGGCACAAACAGG + Intronic
997975969 5:138441357-138441379 GGACAGAGGGAAGCGCTGGCTGG - Intronic
998007399 5:138666078-138666100 GGCCAATGGAAGCCACTGGCAGG - Intronic
998094234 5:139388332-139388354 GGTCCAAGGGAGGGGCTGGCTGG - Intronic
998142985 5:139710169-139710191 GGCTAGTGGGAGGCGCGTGCGGG - Intergenic
999147683 5:149406781-149406803 GGCCAATGGGGGGCCCTGGGAGG + Intergenic
999177033 5:149638946-149638968 GGCCAATGGGAGGCACTGGCAGG + Intergenic
1001077261 5:168639329-168639351 CGCCACTGGGAGTGGCTGGCTGG - Intergenic
1001530234 5:172456070-172456092 GGCCAGTGGAAGGGCCTGGCAGG + Intergenic
1003103391 6:3194784-3194806 AGGAAATGAGAGGCGCTGGCTGG - Intergenic
1003978862 6:11370726-11370748 GGCACATGGGAGGTGCTGGAGGG - Intronic
1004448324 6:15723204-15723226 GTCCAATGGGAGGTACTGGTAGG + Intergenic
1004578374 6:16922510-16922532 GGCCAATGGGAGGCAGTGGCAGG + Intergenic
1004924626 6:20404228-20404250 GGACAAAGGGAGGGGGTGGCGGG - Intronic
1005166584 6:22929005-22929027 GGTCAATGGTAGGCTCTGGCAGG - Intergenic
1005498820 6:26412404-26412426 GGCCAATGGGAGGCCCTGATAGG - Intronic
1006385672 6:33729479-33729501 GCCCAGTGGGGGGCACTGGCAGG + Intronic
1006405728 6:33843691-33843713 GGCCAGTGGGAGGCACCAGCAGG + Intergenic
1007085294 6:39140116-39140138 TGCCAGTGGGAGGCACTGGCAGG + Intergenic
1007189792 6:40003716-40003738 GGCCAATGGGAGGCATGGGCAGG + Intergenic
1007379384 6:41477796-41477818 AGCCAGTAGGAGGCTCTGGCAGG + Intergenic
1007782322 6:44261711-44261733 GGCCAAGTGCTGGCGCTGGCAGG + Exonic
1007897426 6:45377566-45377588 CGGCTGTGGGAGGCGCTGGCCGG - Intronic
1010815871 6:80357405-80357427 AGCCAGTGGGAAGCACTGGCAGG - Intergenic
1010984780 6:82411462-82411484 TGTCAATGGGAGGCAATGGCAGG - Intergenic
1011841360 6:91503728-91503750 AGCCAATGGGAGGCACCAGCAGG + Intergenic
1011852396 6:91646546-91646568 GTCCAGTGGGAGACACTGGCAGG - Intergenic
1011904102 6:92339377-92339399 GACCAGTGGGAGAGGCTGGCAGG + Intergenic
1012243514 6:96900565-96900587 GGCCAATGTCAGGCACAGGCAGG - Intergenic
1014171250 6:118281491-118281513 GGCCAATGGGAGGCAGTAGAGGG + Intronic
1014747212 6:125214175-125214197 GGCCAATGGGAAGCCCCTGCAGG - Intronic
1014946084 6:127499791-127499813 GGCCAATAGAAGGCACTGGCAGG + Intronic
1017039396 6:150295598-150295620 AGCCAGTGGGAGGCACTGGCAGG - Intergenic
1018174001 6:161163616-161163638 GGCACATGGCAGGCACTGGCTGG - Intronic
1018447419 6:163870280-163870302 TGCCACTGTGAGGCGATGGCTGG + Intergenic
1019748380 7:2713311-2713333 GGCCCCTGGGAGCGGCTGGCTGG - Exonic
1020224448 7:6269089-6269111 GGCCACTGGGAGCCACTGGCAGG - Intronic
1020538678 7:9433528-9433550 GGCCAATGGGAGCAGATGACTGG + Intergenic
1022473205 7:30694324-30694346 GGCAAAGGAGAGGCCCTGGCTGG + Intronic
1022665958 7:32410645-32410667 AGCCAATGGGAGGCACTGGTAGG + Intergenic
1023752723 7:43387212-43387234 GCCCAAGGGAAGGGGCTGGCTGG - Intronic
1024055727 7:45658896-45658918 GGCCAATGGGAGCTGCTGATGGG + Intronic
1025887924 7:65615816-65615838 GGCCTATGGTAGACACTGGCTGG - Intergenic
1026571152 7:71532197-71532219 TGCCAATGGGAGGCACAAGCAGG - Intronic
1026584896 7:71648057-71648079 GGCCCATGGGAGGGGCAGGTTGG - Intronic
1026736702 7:72953610-72953632 GGCCAATGGAAGGCTCTGTTGGG - Intergenic
1026871963 7:73858210-73858232 GCACTTTGGGAGGCGCTGGCAGG + Intergenic
1026872019 7:73858510-73858532 GCACTTTGGGAGGCGCTGGCGGG + Intergenic
1027107032 7:75411453-75411475 GGCCAATGGAAGGCTCTGTTGGG + Intergenic
1028343254 7:89748296-89748318 AGCCAATGGAAGGCAATGGCAGG - Intergenic
1029346219 7:99980667-99980689 GGCCAATGGGAGTACCAGGCCGG - Intergenic
1029558958 7:101289848-101289870 GGCCAATGGGAGTACCAGGCCGG + Intergenic
1029650791 7:101890067-101890089 GGCCAGTGGCAGGGACTGGCTGG + Intronic
1030431560 7:109455336-109455358 GGCCAATGGGGAGCACTGCCAGG + Intergenic
1031144086 7:117978720-117978742 GGCCAATGGGAGGCACTCGCAGG + Intergenic
1031852448 7:126881458-126881480 GGCCTATGGAAGGCTCTAGCAGG - Intronic
1032443385 7:131959651-131959673 GGCCAGTGGGAGTAGCTGGCTGG + Intergenic
1033280209 7:140001103-140001125 GGTCAAGGGGAGGCGCTGCAGGG + Intronic
1033544544 7:142388400-142388422 GGCTAATGGGAGACAATGGCAGG - Intergenic
1034044833 7:147916867-147916889 GGGTAATGGGAGGAGATGGCTGG - Intronic
1034405992 7:150902792-150902814 TGCCTCTGGGAGGAGCTGGCCGG + Intergenic
1034779059 7:153860385-153860407 GGCCAGTGGGAGGCACTGGAAGG + Intergenic
1035324597 7:158056769-158056791 GGTCAATGAGAGGCACTGCCAGG - Intronic
1035709740 8:1703591-1703613 GACCAATGTGAGGAGGTGGCGGG - Exonic
1035872343 8:3149720-3149742 GGCTATTGGGAGGCGAAGGCCGG - Intronic
1036179065 8:6567649-6567671 AGCCAATGGGAGGCCCTTGAAGG + Intronic
1036755277 8:11467163-11467185 GGCCCACGGTAGGCGCTCGCGGG - Intronic
1036812928 8:11880053-11880075 AGCCACTGGGATGGGCTGGCAGG + Intergenic
1037210334 8:16378308-16378330 GGCCAATGCGAAGCCCTTGCAGG - Intronic
1037664352 8:20955358-20955380 GGCCAATGGGGCGTTCTGGCAGG + Intergenic
1037906377 8:22718248-22718270 GGCCTAGGGGATGCACTGGCTGG - Intronic
1038716226 8:29993756-29993778 TGCCAGTGGGATGCGCTGGTGGG - Intergenic
1039171356 8:34749512-34749534 AGCCAACGGGAGGTGCTGGAGGG - Intergenic
1040664416 8:49615552-49615574 GGCCAGTCGGAGGCTCTGCCGGG + Intergenic
1043483767 8:80678875-80678897 GGCTAATGAGAGGCACCGGCAGG + Intronic
1044434764 8:92148926-92148948 GGTCAATGGGAGGTACTGGTAGG - Intergenic
1044607184 8:94057685-94057707 GGCCAATGGGCAGCACTGGCAGG - Intergenic
1045376367 8:101578405-101578427 TGCCGATGGGAGGCACTGGCAGG - Intronic
1046739205 8:117810818-117810840 GGTCAATGGGAGTCACCGGCAGG + Intronic
1047441222 8:124880260-124880282 GGCCATTGGGAAGTGCTGGGGGG + Intergenic
1047451038 8:124965157-124965179 GGCCAATGAGAGGCACTGACAGG - Intergenic
1047745217 8:127839926-127839948 AGCCAATGGGAGGCACCAGCAGG - Intergenic
1048226361 8:132590191-132590213 GGCCAATGGGAGGCAATGGAGGG + Intronic
1048534239 8:135277544-135277566 GGCCAGTGGGAGCCTCTGGAAGG + Intergenic
1048945812 8:139446053-139446075 AGCCAATGGGAGGTGCTTTCAGG + Intergenic
1048970939 8:139644721-139644743 GGGCAGTGGGAGGCTCTGGGGGG - Intronic
1049089745 8:140505678-140505700 GGCCAAGGGGAGAGGCTGGTGGG + Intergenic
1049403902 8:142443177-142443199 GGCCAAGGGCAGGCGCAGGGAGG + Intergenic
1049597043 8:143489507-143489529 GGGCCAGGGGAGGAGCTGGCTGG + Intronic
1050429690 9:5549950-5549972 AGCCAATGGGAGGTGCTAGCAGG - Intronic
1051728264 9:20111186-20111208 GGCAAATGGGAGGCACCGGTAGG + Intergenic
1051932718 9:22406247-22406269 GGGCCCTGGGAGGAGCTGGCAGG - Intergenic
1054851860 9:69854708-69854730 GGCCCATGGGAGGCACTGGCAGG + Intronic
1055650586 9:78403215-78403237 TGCAAATGGGAGGCACTGGCAGG + Intergenic
1056170502 9:83980363-83980385 GCCCGAAGGGAGGCGCTGGCGGG - Intronic
1056534660 9:87517050-87517072 GGCTAATGAGAGGCACTGGTGGG - Intronic
1056733485 9:89185125-89185147 GGCCAATGGGAGGCACCAACAGG - Intergenic
1056789728 9:89617739-89617761 GGCCAATGAGAGGTGTTGGTGGG + Intergenic
1058153813 9:101489656-101489678 AGCCAATGGGAGACACTAGCAGG - Intronic
1058919587 9:109600235-109600257 GGCTGATGGGAGGCACAGGCAGG + Intergenic
1060401657 9:123353220-123353242 AGCCAGTGGGAGGCACAGGCCGG - Intergenic
1060509406 9:124221216-124221238 GGCCAAGGGGAAGCACTGGCAGG + Intergenic
1060730673 9:126034881-126034903 AGCCTATGGGAAGCACTGGCAGG - Intergenic
1060732627 9:126048081-126048103 GGCCACTGGGAGGAACAGGCGGG - Intergenic
1060752962 9:126186181-126186203 ACCCAATGGGAGGCACTGGCAGG - Intergenic
1060786312 9:126454063-126454085 GACCAAAGGGAGGTGCTAGCAGG - Intronic
1060827464 9:126695220-126695242 GGCCGCTGGGAGCCGCTGGAGGG - Intronic
1060929457 9:127479696-127479718 GCCTACTGGGAGGAGCTGGCCGG + Intronic
1061045696 9:128163757-128163779 GGCCAAGGGGAGGCCCAGGCAGG - Exonic
1061522217 9:131125488-131125510 GGCCAATGGGGAGCGGCGGCCGG + Intergenic
1061689420 9:132314041-132314063 AGCTAATGGGAGGCGGAGGCGGG - Intronic
1061708109 9:132468473-132468495 GGCCCAGGGCAGGGGCTGGCAGG - Intronic
1062084461 9:134641653-134641675 GCCCAGTGGGAGGCGGGGGCTGG + Intergenic
1062271797 9:135713229-135713251 GGCCATGGGGAGGTGCAGGCAGG - Intronic
1062591936 9:137278253-137278275 GTCCAGTGGGAGCCGCGGGCGGG + Intronic
1062646766 9:137551784-137551806 GGCCAATGCGAGGAGCGCGCGGG - Exonic
1186352562 X:8755203-8755225 GGCTAATGGGAGGCAGTGGCAGG + Intergenic
1186508397 X:10111836-10111858 AGCAAATGGGAGGCGTTTGCCGG + Intronic
1186748694 X:12598467-12598489 AAACAATGGGAGGTGCTGGCAGG - Intronic
1186776056 X:12865696-12865718 GGCCAATAGGAGGCCGTGGTTGG - Intergenic
1187192223 X:17045967-17045989 GGGGAATGGGAGGAGATGGCCGG + Intronic
1187223823 X:17356332-17356354 AGCCAATGGGAGGCCCCAGCAGG - Intergenic
1187571806 X:20511637-20511659 GGCCAATGGGAAGCCCCAGCAGG + Intergenic
1188524680 X:31076011-31076033 AGTCAACGGGAGGCACTGGCAGG + Intergenic
1188597262 X:31916689-31916711 AACCAGTGGGAGGCGTTGGCAGG - Intronic
1189807388 X:44749472-44749494 GGCCTTTGGGAGGCCCAGGCGGG - Intergenic
1189921023 X:45903498-45903520 GGTCAATGGGAGGCACCAGCTGG + Intergenic
1190009101 X:46767883-46767905 TGCCAATGGGAGGCACTTGTGGG - Intergenic
1194956465 X:100186835-100186857 GGCCAATGGGAGGTGTCAGCAGG - Intergenic
1195962198 X:110397684-110397706 GGCCAATGGAAGGCACTGTTAGG - Intronic
1196174783 X:112628508-112628530 GGCCAATGATAGGCACTGGCAGG + Intergenic
1197837007 X:130705726-130705748 GGTCAGTGGGAGGCTCTGCCAGG - Intronic
1197905985 X:131426488-131426510 GGCCAATGGGGGCAGCTGGGAGG - Intergenic
1199151326 X:144490297-144490319 GGCCAATGAGAGCCTCCGGCAGG - Intergenic
1199160293 X:144601653-144601675 GGCTAATGGGAGGCACTAGCAGG + Intergenic
1199504298 X:148544135-148544157 GGCAAATGGGTGGCCCTGGGAGG - Intronic
1200207648 X:154328900-154328922 GGCCAAGGGGAGGCTGGGGCAGG - Intronic