ID: 1121613517

View in Genome Browser
Species Human (GRCh38)
Location 14:95297260-95297282
Sequence TAAGCAGGACTGCACAAAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 158}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121613517_1121613520 15 Left 1121613517 14:95297260-95297282 CCACTTTTGTGCAGTCCTGCTTA 0: 1
1: 0
2: 2
3: 10
4: 158
Right 1121613520 14:95297298-95297320 GTCATTAAAAAACTGTGATAAGG 0: 1
1: 0
2: 2
3: 24
4: 232

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121613517 Original CRISPR TAAGCAGGACTGCACAAAAG TGG (reversed) Intronic
901737044 1:11319338-11319360 TCACCAGGACTACACAAATGGGG + Intergenic
902239605 1:15079820-15079842 TAAGAAGGACTTCCCAAATGTGG + Intronic
907832777 1:58080894-58080916 TAAGCAGGACTGCAGATAATGGG - Intronic
908674760 1:66591402-66591424 TAAGCAGGACTGGAAAAAGAAGG - Intronic
911196242 1:94998049-94998071 TTAGCTGAACTGCACAAAATAGG - Intronic
913090838 1:115475527-115475549 TGAGGAGGGCTGCACAACAGTGG + Intergenic
915786901 1:158623601-158623623 AAAGAAGTGCTGCACAAAAGGGG - Intronic
917232972 1:172857814-172857836 TAACCAGGTCTGAAGAAAAGAGG + Intergenic
918864680 1:189880120-189880142 AAAGCACAACTGCACCAAAGAGG - Intergenic
918982247 1:191578128-191578150 TAAGAAGGACTCTACAAAGGAGG - Intergenic
919961245 1:202471712-202471734 TAATCAGGAATTCACAAAAAAGG - Intronic
920251713 1:204626341-204626363 TGAGCAGGAAAGCCCAAAAGAGG - Intronic
920491566 1:206419614-206419636 TAAGCAGAACTGAGTAAAAGGGG + Intronic
920799793 1:209175336-209175358 TAAGCAGTAGTTCTCAAAAGTGG - Intergenic
922841566 1:228647105-228647127 TATTCCGGACTGCTCAAAAGGGG - Intergenic
924632294 1:245752383-245752405 TAACCAGGAGGGCAAAAAAGAGG - Intronic
1062957648 10:1550939-1550961 TAAAAAGGACGGCAGAAAAGGGG + Intronic
1064957788 10:20930596-20930618 AAAGCTGGACTGAGCAAAAGGGG - Intronic
1065771116 10:29079629-29079651 TATGCAGGACTGACAAAAAGAGG - Intergenic
1071042154 10:81324496-81324518 TAATCAGAACTGCAAAAAAATGG - Intergenic
1071895669 10:90063946-90063968 TGAGCAGGCCTGGACCAAAGGGG + Intergenic
1072194664 10:93106943-93106965 TACACAAGACTGCAGAAAAGTGG - Intergenic
1072833371 10:98683720-98683742 TCAGAAGGAATGCACAAAAAAGG + Intronic
1073518527 10:104102025-104102047 TAAGCAGGAGTTCAAGAAAGAGG - Intergenic
1075731595 10:124639695-124639717 TAAACAGTAATGAACAAAAGGGG - Intronic
1084687727 11:70706863-70706885 TAAGCAGGGCTGCTGGAAAGAGG + Intronic
1085728767 11:78978523-78978545 GAAGCAGGAATGAACCAAAGTGG + Intronic
1085911565 11:80833026-80833048 TAAGGAGTACTACATAAAAGAGG - Intergenic
1089777947 11:120852040-120852062 GAAGCAAGCCTGCAGAAAAGCGG + Intronic
1090457274 11:126860969-126860991 AAAGCAGGAGGGCACAAAGGAGG - Intronic
1093000143 12:13987238-13987260 TAAGCAGGTCTTCAGACAAGGGG - Intergenic
1093090664 12:14916731-14916753 CAAGCAGAACTCCACAAAGGAGG + Intronic
1096974480 12:55692041-55692063 AAAGCAAAACTGCTCAAAAGGGG + Intronic
1099681516 12:85835865-85835887 GAAACAGGACTGGTCAAAAGGGG + Intronic
1100405846 12:94272371-94272393 TAAGCAGGGCTGTAGAAAGGAGG + Intronic
1101527231 12:105542404-105542426 CAATCATGACTGCACAAAAGAGG - Intergenic
1101742789 12:107513978-107514000 TAAACAGGACTGCACATCTGTGG + Intronic
1101976312 12:109362598-109362620 GAAGTAGGATTGGACAAAAGAGG + Intronic
1103017945 12:117510300-117510322 TAACCAAGACTACAGAAAAGTGG - Intronic
1105583712 13:21724520-21724542 TAGGCAGCACTGGACACAAGCGG - Intergenic
1106653539 13:31717802-31717824 GAAGTATGACTGGACAAAAGGGG - Intergenic
1107536913 13:41344402-41344424 TAAGAAGTACTGCTCTAAAGAGG - Intronic
1109515533 13:63439065-63439087 CAGGCAGCACAGCACAAAAGAGG + Intergenic
1110010292 13:70324698-70324720 AAAGCAGGACTGCGCAGAGGGGG - Intergenic
1110578111 13:77084179-77084201 TAAGGAGAACTTCATAAAAGTGG + Intronic
1111237031 13:85422735-85422757 AAAACAGTACTGCACAAAATAGG + Intergenic
1112736372 13:102424507-102424529 GAACCAGCACTCCACAAAAGAGG + Intergenic
1113226904 13:108169092-108169114 ACAGCAGCACTGCAGAAAAGTGG + Intergenic
1114618762 14:24082404-24082426 GAAGGAGGACTGCCCAAGAGAGG - Intronic
1115876884 14:37870849-37870871 TAAGCAGGGCTGCTGAGAAGGGG - Intronic
1117675432 14:58151248-58151270 CAAGCAGGAGTGAACAAAACAGG - Intronic
1118045414 14:61965195-61965217 TAATCAGGGTTGCACAAAAAGGG - Intergenic
1121613517 14:95297260-95297282 TAAGCAGGACTGCACAAAAGTGG - Intronic
1123394206 15:19912220-19912242 CAAGAAGGGCTGCAGAAAAGAGG + Intergenic
1127848218 15:62890217-62890239 TAAGCAGGAGTGAACTAACGTGG - Intergenic
1131435293 15:92417085-92417107 TAAGAAGGACTGGACAGAGGTGG - Intronic
1131760079 15:95612930-95612952 TGAGCAGGAATGAACAAAGGTGG + Intergenic
1133310141 16:4840148-4840170 TGAGGAGCACTGCATAAAAGGGG - Intronic
1135089314 16:19500300-19500322 GAAGCAGGGCTGCACTGAAGTGG - Intergenic
1136700226 16:32130109-32130131 CAAGAAGGACTGCAGAAAGGAGG + Intergenic
1138888810 16:61115631-61115653 AAAGCAGGACAGCTTAAAAGAGG + Intergenic
1143202186 17:5120804-5120826 TAAGCAGGTGTGCACACATGTGG + Intronic
1143532011 17:7510868-7510890 GGCGCAGGACTGCACAAGAGTGG + Intronic
1145203501 17:20967900-20967922 GAACCAGGACTGCATCAAAGAGG - Intergenic
1147836654 17:43337623-43337645 TAATGTGGAATGCACAAAAGGGG + Intergenic
1150880073 17:69014609-69014631 GAAGCAGGACTGCTGAAACGTGG + Intronic
1154069678 18:11142053-11142075 CAAACAGTACGGCACAAAAGGGG + Intronic
1155339452 18:24799262-24799284 AAAGCAGATCTGCACAAAAAGGG - Intergenic
1155589041 18:27403640-27403662 TAAGCAGGACTGAAGAAGATGGG + Intergenic
1156455761 18:37293034-37293056 CCAGCAGGACCCCACAAAAGGGG + Intronic
1157925646 18:51763139-51763161 ACAGCAGAACTCCACAAAAGAGG + Intergenic
1168583324 19:57573415-57573437 CAGGCAGCACTGCACAAATGAGG + Exonic
926010352 2:9401566-9401588 TAATCAGGCCTGCTCAGAAGGGG - Intronic
926869313 2:17395070-17395092 TAAGCAGCACTGCAAATCAGTGG + Intergenic
930635548 2:53801592-53801614 TTAGGATGACTGCACAAGAGTGG - Exonic
931936929 2:67209038-67209060 TAAGCAAGATGGAACAAAAGAGG - Intergenic
932202345 2:69841920-69841942 TAAGAAGGATTGCAGAAGAGGGG + Intronic
932556982 2:72833152-72833174 TTATCAGGACTCCACAAAAGAGG - Intergenic
932911455 2:75810239-75810261 TAAGCCAGTCTGCACAAAAATGG + Intergenic
937563314 2:123252208-123252230 CAAACAGAACTGCACAAAAGAGG - Intergenic
939696102 2:145326818-145326840 TGAGAAGTACTGCAAAAAAGAGG - Intergenic
941859806 2:170267305-170267327 TATGGAGGACTGCACAAGAGTGG + Intronic
943841595 2:192590287-192590309 TATGAAAGACTGCACGAAAGTGG + Intergenic
945482103 2:210356946-210356968 GCAGCAGAACTGCAGAAAAGGGG - Intergenic
1170396186 20:15927867-15927889 TAAGCAGGACTGAGAAAAATAGG + Intronic
1176890606 21:14313582-14313604 TAAGCAGGAATGAGCAAACGTGG - Intergenic
1180587836 22:16908694-16908716 TACGCAAGAATGCATAAAAGGGG - Intergenic
1181747526 22:24966242-24966264 TAAACAGGACTCCCCAGAAGAGG - Intronic
1182893605 22:33840196-33840218 AAAGCAGCACTGCACCAAATCGG + Intronic
1184250119 22:43255304-43255326 CACGCAGGACTGCACACACGTGG + Intronic
950612545 3:14135432-14135454 TAAGAAGGGCAGCTCAAAAGGGG + Intronic
950892876 3:16420211-16420233 TGAGCTGGGCTGCAGAAAAGAGG + Intronic
951508114 3:23471739-23471761 TAAGCAGTACAGGACAAAAGGGG + Intronic
951801483 3:26601444-26601466 TAAGCAGGATTGGAGGAAAGAGG + Intergenic
952026477 3:29088451-29088473 TAAGAAGAAATGCCCAAAAGAGG + Intergenic
955579414 3:60402948-60402970 TGAGCATGACTGTACAAAGGTGG - Intronic
958557016 3:95692380-95692402 TGAGCAGTACTGCAAAGAAGTGG + Intergenic
960814860 3:121661966-121661988 TAAGCAGGACTGGATGAAACTGG + Intergenic
961310279 3:125993726-125993748 TTGGCAGGAATCCACAAAAGAGG - Intergenic
961857927 3:129891856-129891878 TAAGCAGTCTTGCAGAAAAGGGG + Intronic
965744863 3:171913921-171913943 TAAGCAGGACTGGACAACAGAGG - Intronic
968866503 4:3216111-3216133 CAACCAGGATTGCACAAAAGCGG - Intronic
971197478 4:24483180-24483202 TGAGCAGGTCTGCACATGAGGGG + Intergenic
975382687 4:73720310-73720332 TGAGCAGGACTTCAGAAAATTGG - Intergenic
976828186 4:89283713-89283735 TAAGCAGGACTTCACCAGTGGGG + Intronic
977229906 4:94439521-94439543 GAAGGATGACTGCACAAAAGGGG - Intergenic
979219657 4:118207928-118207950 TACCCAGAACTGCACATAAGAGG - Intronic
980062029 4:128141574-128141596 TAAGTAGTACTGGACAAAACTGG - Intronic
980592622 4:134911152-134911174 TGAGAAAGAGTGCACAAAAGAGG - Intergenic
982859724 4:160434198-160434220 GAAGCAGCCCTGCAGAAAAGGGG - Intergenic
983347684 4:166547321-166547343 TTAGTAGGACTGGACTAAAGAGG + Intergenic
988075734 5:26352127-26352149 TAAAAAGGACAGCACAAACGAGG - Intergenic
989101364 5:37826383-37826405 AAAGCAAGATTGCCCAAAAGGGG + Intronic
990642505 5:57803529-57803551 TAAGCAATACTGCACAACTGAGG - Intergenic
990702832 5:58493810-58493832 TAAGCAGGGCTTCACAGAAGAGG + Intronic
990744554 5:58946357-58946379 TAAGTAGGACTGCACAGACTTGG - Intergenic
991635579 5:68701511-68701533 TAAGCAGGAGTCCCCAAAAAGGG + Intergenic
997008359 5:129847577-129847599 AAAGCAGGCCTGCCCAAAGGAGG - Intergenic
1002392875 5:178929421-178929443 TAAGCAGCAAAGCACACAAGAGG - Intronic
1006394486 6:33778196-33778218 TATGCTTGACTGCACAGAAGGGG + Intronic
1006752980 6:36390950-36390972 TAAGCAGGCATGCCTAAAAGAGG + Exonic
1006854693 6:37124685-37124707 GAAACAGGATTGGACAAAAGGGG - Intergenic
1008043153 6:46823248-46823270 TATGCAGGACTGCAGAAGTGTGG - Intronic
1008246326 6:49178415-49178437 TCAGGAGGACAGCACTAAAGGGG + Intergenic
1008247555 6:49196532-49196554 TAAGCAGAGATGCAGAAAAGGGG - Intergenic
1008473937 6:51915883-51915905 CAAGCAGAACTGCTAAAAAGGGG + Intronic
1010430621 6:75774734-75774756 TAAGCACCACTTCATAAAAGTGG - Intronic
1010743305 6:79532606-79532628 TAATTAGAACTTCACAAAAGTGG + Intronic
1012136596 6:95564947-95564969 AAAGCAGGATTGAACAAGAGTGG - Intergenic
1012174213 6:96059382-96059404 TATGCAGGTGTGCACACAAGTGG - Intronic
1014533574 6:122590039-122590061 AAATCAGGACAGAACAAAAGGGG + Intronic
1014899530 6:126945936-126945958 TCAGGAGAACTGCACAAAATTGG - Intergenic
1017140670 6:151187165-151187187 GAACAAGGACTTCACAAAAGAGG + Intergenic
1020777773 7:12476607-12476629 TAAACAGAAATGCACAAAATAGG + Intergenic
1021791191 7:24207633-24207655 GAAGCAGTACTGGACAGAAGAGG + Intergenic
1021912453 7:25400064-25400086 TAAGCAAAACTGCAGATAAGTGG - Intergenic
1024491789 7:49994252-49994274 TATGCAGGACCACCCAAAAGTGG - Intronic
1025319019 7:58071493-58071515 TAAGAAGGGCTGCAGAAAGGAGG + Intergenic
1025477438 7:60942105-60942127 CAAGAAGGACTGCAGAAAGGAGG + Intergenic
1026394868 7:69941251-69941273 TCAGCAGCACTGCACAACAGTGG + Intronic
1030681235 7:112436614-112436636 TAATCAGGTCTTCATAAAAGGGG + Intronic
1031824859 7:126551294-126551316 TAAGGAGGGCTTCAAAAAAGAGG - Intronic
1033931057 7:146522531-146522553 TAGGCTGGACTGCTCAAAAATGG - Intronic
1034071597 7:148191237-148191259 AGAGCAAGAGTGCACAAAAGGGG - Intronic
1040347707 8:46524531-46524553 TAATCAGCACATCACAAAAGTGG - Intergenic
1040984403 8:53278275-53278297 TCAGCAGGCCTGCAGAGAAGTGG + Intergenic
1047122489 8:121921467-121921489 TAAGAAGGATAGCACTAAAGGGG + Intergenic
1052172623 9:25420141-25420163 GAAGCAGCACAGAACAAAAGAGG + Intergenic
1052844901 9:33326844-33326866 TAACAATAACTGCACAAAAGGGG + Intronic
1053147943 9:35724548-35724570 TAAGCAGAACTAGAAAAAAGAGG - Intronic
1053298325 9:36930985-36931007 GAAGGAGGGCAGCACAAAAGAGG + Intronic
1058576108 9:106403409-106403431 TAACCAGGAATGTACAAAAAAGG + Intergenic
1059627152 9:116079487-116079509 TAAGCAGGGCTTCACAGGAGGGG - Intergenic
1060835262 9:126751041-126751063 TAAGCAGGTATGCAGAGAAGTGG - Intergenic
1203700238 Un_GL000214v1:129034-129056 TAAGCGGAATTGCACAATAGGGG - Intergenic
1203570543 Un_KI270744v1:125285-125307 TAAGCGGAATTGCACAATAGGGG - Intergenic
1185503597 X:616886-616908 GAAACAGGATTGCACAAAAAGGG - Intergenic
1189143374 X:38630075-38630097 TAAGGAGAAATGAACAAAAGGGG + Intronic
1189688234 X:43588091-43588113 TAAGGAAGACTGGACAACAGAGG + Intergenic
1191838287 X:65488873-65488895 TAAGCAGGACAGCACAGAGCAGG + Exonic
1193541908 X:82782444-82782466 TAAGCAGCAAAGCACTAAAGAGG - Intergenic
1194261901 X:91706052-91706074 TGAGCATGACTGGACAAGAGAGG - Intergenic
1195376608 X:104234101-104234123 TAGGCAGGACTGAACAAAAGTGG + Intergenic
1197300956 X:124779990-124780012 TTAGCAGGAAAACACAAAAGAGG + Intronic
1197999601 X:132419315-132419337 GAAGTAGGACTCAACAAAAGAGG + Intronic
1198880650 X:141277437-141277459 TAAGCACCACTGAACAAATGTGG - Intergenic
1199621338 X:149704426-149704448 GAAGCAGGAGTGAAAAAAAGGGG - Intronic
1202161641 Y:21940939-21940961 TAAGCAGGACAGCTGAGAAGGGG + Intergenic
1202229715 Y:22645434-22645456 TAAGCAGGACAGCTGAGAAGGGG - Intergenic
1202313441 Y:23550731-23550753 TAAGCAGGACAGCTGAGAAGGGG + Intergenic
1202557362 Y:26119864-26119886 TAAGCAGGACAGCTGAGAAGGGG - Intergenic