ID: 1121613811

View in Genome Browser
Species Human (GRCh38)
Location 14:95299396-95299418
Sequence TGCGTGTCCCGTGGGGCTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 229
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 206}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121613811_1121613818 -10 Left 1121613811 14:95299396-95299418 CCTCCAGCCCCACGGGACACGCA 0: 1
1: 0
2: 0
3: 22
4: 206
Right 1121613818 14:95299409-95299431 GGGACACGCACCAGGGCTTCCGG 0: 1
1: 0
2: 0
3: 22
4: 233

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121613811 Original CRISPR TGCGTGTCCCGTGGGGCTGG AGG (reversed) Intronic
900291740 1:1926572-1926594 GGGGTGGGCCGTGGGGCTGGGGG + Intronic
900762703 1:4483565-4483587 AGCCAGTCCCGGGGGGCTGGAGG + Intergenic
900870231 1:5297121-5297143 TGCTGCTCCCGTGGGGCAGGTGG + Intergenic
901023568 1:6267376-6267398 TGGGTGTCCTGGGGGGCTGGTGG + Intronic
901677745 1:10896900-10896922 TGGGTACCCAGTGGGGCTGGGGG + Intergenic
901936436 1:12630286-12630308 TGCATGTTCCATGGAGCTGGTGG + Intergenic
902534957 1:17114202-17114224 TGCCTGTCCCTTGAGGCTGGGGG + Intronic
903335491 1:22621733-22621755 TGCCTGCCCCATGGGGCTGTGGG - Intergenic
903967353 1:27099116-27099138 CCCCTGTCCCCTGGGGCTGGTGG - Exonic
907706601 1:56837882-56837904 TCCTTGTCCGGAGGGGCTGGAGG + Intergenic
909744506 1:79076653-79076675 TGTGGGTCCAGTGGGGATGGAGG + Intergenic
911052142 1:93680769-93680791 GGCGTGTTCCGTGGGGCGGCGGG - Intronic
913969512 1:143403976-143403998 TGCTTGTCTGGTGGGGATGGTGG - Intergenic
914063889 1:144229575-144229597 TGCTTGTCTGGTGGGGATGGTGG - Intergenic
914115261 1:144736779-144736801 TGCTTGTCTGGTGGGGATGGTGG + Intergenic
914675436 1:149904320-149904342 TGCATGTGCCATGGGGCGGGGGG - Exonic
915311915 1:155009281-155009303 GGGGTGTCCTCTGGGGCTGGGGG + Intronic
917678479 1:177342120-177342142 TGCGTGTCCTGTGTGGCTGTTGG - Intergenic
1062819233 10:521877-521899 TGCTGGTCCGGTGGGGGTGGGGG - Intronic
1066047130 10:31603734-31603756 TGGGAGTCCCGTGGGGCTTGAGG - Intergenic
1067277413 10:44847797-44847819 TGCATGCCACCTGGGGCTGGAGG - Intergenic
1067711656 10:48655658-48655680 TGCGTGGCCCATGCTGCTGGCGG - Intronic
1068721354 10:60249850-60249872 TGCGTGACCTGTGGAGCTGGTGG - Intronic
1071564313 10:86663762-86663784 TTCGTGTCCCTGGGGTCTGGGGG - Exonic
1071592744 10:86891151-86891173 TGCTTGTCCCCTGGTGGTGGTGG + Intronic
1073442131 10:103558540-103558562 TGTGTGTGTAGTGGGGCTGGTGG + Intronic
1076626103 10:131822942-131822964 TGCGTCTCCTGTGGGGGTGCAGG - Intergenic
1076626148 10:131823113-131823135 TGCGTCTCCTGTGGGGGTGCAGG - Intergenic
1076626161 10:131823156-131823178 TGCGTCTCCTGTGGGGGTGTAGG - Intergenic
1076626172 10:131823199-131823221 TGCGTCTCCTGTGGGGGTGCAGG - Intergenic
1076626185 10:131823242-131823264 TGCGTCTCCTGTGGGGGTGTAGG - Intergenic
1076626225 10:131823372-131823394 TGCGTCTCCTGTGGGGGTGCAGG - Intergenic
1076626238 10:131823415-131823437 TGCGTCTCCTGTGGGGGTGTAGG - Intergenic
1076626248 10:131823458-131823480 TGCGTCTCCTGTGGGGGTGTAGG - Intergenic
1076626258 10:131823500-131823522 TGCGTCTCCTGTGGGGGTGCAGG - Intergenic
1076626271 10:131823543-131823565 TGCGTCTCCTGTGGGGGTGCAGG - Intergenic
1076626284 10:131823586-131823608 TGCGTCTCCTGTGGGGGTGTAGG - Intergenic
1076626294 10:131823629-131823651 TGCGTCTCCTGTGGGGGTGTAGG - Intergenic
1076626304 10:131823671-131823693 TGCGTCTCCTGTGGGGGTGCAGG - Intergenic
1076626317 10:131823714-131823736 TGCGTCTCCTGTGGGGGTGCAGG - Intergenic
1076626327 10:131823756-131823778 TGCGTCTCCTGTGGGGGTGTAGG - Intergenic
1076626395 10:131824009-131824031 TGCGTCTCCTGTGGGGGTGCAGG - Intergenic
1076626408 10:131824052-131824074 TGCGTCTCCTGTGGGGGTGTAGG - Intergenic
1076626418 10:131824094-131824116 TGCGTCTCCTGTGGGGGTGCAGG - Intergenic
1076626452 10:131824222-131824244 TGCGTCTCCTGTGGGGGTGCAGG - Intergenic
1076626472 10:131824307-131824329 TGCGTCTCCTGTGGGGGTGCAGG - Intergenic
1076675551 10:132145844-132145866 TTCGTGTCCCGTTGTGCTGATGG + Intronic
1076994103 11:289946-289968 GGCGTGTACAATGGGGCTGGCGG + Exonic
1077046872 11:550616-550638 TGTGGGGCCTGTGGGGCTGGAGG - Intronic
1077143026 11:1033195-1033217 TCCATGGCCCGTGGGGCTCGAGG + Intronic
1078174963 11:8963803-8963825 TGCGGGGCCTGTGAGGCTGGCGG + Intronic
1083232638 11:61332895-61332917 TGCGTGACCGGTGAGGCTGCCGG - Exonic
1083431718 11:62616751-62616773 AGTGTGGCCTGTGGGGCTGGTGG - Exonic
1083997187 11:66278345-66278367 GGCATGGCCCGTGGGGCTCGGGG - Exonic
1084332249 11:68437077-68437099 TGCCTTTCCAGCGGGGCTGGGGG + Intronic
1085809575 11:79667951-79667973 TGCTTTTGCCTTGGGGCTGGAGG + Intergenic
1086329902 11:85743699-85743721 TTCATGAACCGTGGGGCTGGTGG - Intronic
1088699287 11:112397703-112397725 TGCATGTCCCGGGGGGCAGGTGG - Intergenic
1089457729 11:118635073-118635095 GGCGTGGCCCGCGGGGCCGGGGG - Intronic
1091001157 11:131911432-131911454 GGCGTGTGCCGTGCGGCTGCCGG + Intronic
1092055812 12:5507176-5507198 TGCATGCCTGGTGGGGCTGGAGG + Intronic
1094841303 12:34343741-34343763 TGCGTGGCAGGTGGGGCTTGCGG - Intergenic
1099576971 12:84393949-84393971 TGCGTGTTCCGGGGGGGGGGGGG - Intergenic
1101897968 12:108770081-108770103 TTCCTGTACCGTGGGGCTGGTGG - Intergenic
1106252427 13:27992452-27992474 TGCCTGCACCTTGGGGCTGGGGG + Intergenic
1111074933 13:83221821-83221843 TGTTTGCCCCGTTGGGCTGGTGG - Intergenic
1113675284 13:112202704-112202726 CGCGTGTCCCGTGTGAGTGGCGG - Intergenic
1113900245 13:113792943-113792965 TGCGTATCCCGTGGGGACGCTGG + Intronic
1114259094 14:21024934-21024956 TCCGCGTCCCCTGGAGCTGGAGG - Exonic
1121613811 14:95299396-95299418 TGCGTGTCCCGTGGGGCTGGAGG - Intronic
1122178744 14:99939496-99939518 TGTGGGTCCTGTGGGGCTTGGGG - Intronic
1122523380 14:102362889-102362911 TGCGTTTCCGGTGGGGTGGGCGG - Exonic
1123713094 15:23005196-23005218 TGCCTGTCCCCAGGGGCTGCTGG + Intronic
1127396811 15:58549812-58549834 TGGCTGTCCCTTAGGGCTGGAGG + Intronic
1131553999 15:93380883-93380905 TGCGTGTTCCGGTGGCCTGGGGG + Intergenic
1132544544 16:527343-527365 TCCGTGTCCCGCGGGGCTCTGGG - Intergenic
1132579340 16:677931-677953 TGCGGGACCAGTGCGGCTGGTGG + Exonic
1132798754 16:1741194-1741216 GGCGTGACCCCTGGGGGTGGTGG + Intronic
1133035244 16:3030672-3030694 TGAGTGTCAGCTGGGGCTGGGGG - Intronic
1133281818 16:4671063-4671085 TGCTTTCCTCGTGGGGCTGGTGG + Intronic
1135167701 16:20155456-20155478 TGCGGGCCCAGTGGTGCTGGTGG + Intergenic
1137606092 16:49787785-49787807 TGCTTTCCCGGTGGGGCTGGAGG - Intronic
1138388012 16:56649317-56649339 TGAGGGTCCTCTGGGGCTGGAGG + Intronic
1140224474 16:73066872-73066894 TCCGTATCCCGCGGGGCTGGGGG - Intergenic
1141455507 16:84139039-84139061 TGCGTGTGACGTGGGGCGGGTGG + Intronic
1142144034 16:88485253-88485275 GGCCTGTCCCCTGGTGCTGGGGG + Intronic
1143202086 17:5120248-5120270 TGCCTGTGCTGTGGGGTTGGTGG + Intronic
1143523447 17:7459320-7459342 TGCGTGGCTGGTGGGTCTGGGGG - Intergenic
1144819926 17:18065406-18065428 TGGCTGGCCCGTGGGGCAGGTGG + Exonic
1144879100 17:18421802-18421824 TGCCTGTGCTGTGGGGTTGGTGG + Intergenic
1144961889 17:19049085-19049107 TGGGTGTCCCCTGGGGCGGTGGG + Intergenic
1144973272 17:19125437-19125459 TGGGTGTCCCCTGGGGCGGTGGG - Intergenic
1145153134 17:20522585-20522607 TGCCTGTGCTGTGGGGTTGGTGG - Intergenic
1145732299 17:27200072-27200094 TGCCTGTTTCTTGGGGCTGGTGG - Intergenic
1146471934 17:33131665-33131687 TGGGAGTCCTGTGAGGCTGGAGG + Intronic
1148865530 17:50626326-50626348 TTCAGGTCCCGTGGGGATGGGGG - Exonic
1150004627 17:61462334-61462356 CGCGTGTGCCGTGGGGAGGGCGG + Intronic
1151207254 17:72516924-72516946 TGTGTGTCCTGTGGGGCGAGAGG - Intergenic
1151478161 17:74355255-74355277 TGCTTGTGCCGTGGGGCAGGCGG - Exonic
1151820469 17:76494115-76494137 TGTGTGTTGCGGGGGGCTGGGGG + Intronic
1151979108 17:77498508-77498530 TGTGCGTCCTGTGGGGGTGGGGG - Exonic
1152068547 17:78124327-78124349 TGGGGTTCCCATGGGGCTGGAGG - Intronic
1152265934 17:79294757-79294779 TGTGTGTCCCGTGAGGCATGGGG - Intronic
1152824969 17:82458865-82458887 TGCTTGTCCTGTGGGGCTCTGGG + Intronic
1154349737 18:13572964-13572986 TGCCTGCTCTGTGGGGCTGGAGG + Intronic
1158023575 18:52870256-52870278 AGCAGGTCCCGTGGGGGTGGGGG + Intronic
1160871790 19:1281149-1281171 CGCGTGTCCCACGGGGCTGCGGG - Intergenic
1161034470 19:2076763-2076785 TGCGGTTACGGTGGGGCTGGTGG - Intronic
1161284633 19:3463069-3463091 CGGGTCTCCCGTGGGGGTGGCGG - Intronic
1161448306 19:4329928-4329950 CGCCTGTCCCGAGGGGCTGCAGG - Intronic
1161566774 19:5006899-5006921 TGCCTTTCCCATGGGGCTGCTGG + Intronic
1161628431 19:5339791-5339813 TGCGGAACCCGCGGGGCTGGCGG + Intronic
1163535445 19:17873934-17873956 TGCGTACCCCGTGGACCTGGAGG - Intronic
1163722581 19:18905249-18905271 TAACTGTGCCGTGGGGCTGGCGG - Intronic
1165154426 19:33778408-33778430 GGCGGGTCCCCTGGAGCTGGTGG - Intergenic
1166331558 19:42080719-42080741 CGAGTGGCCCGTGGGGCTCGAGG - Exonic
1167019187 19:46861349-46861371 GGCGGGGCCCGGGGGGCTGGGGG - Intergenic
1167045104 19:47045243-47045265 TGCGTTTGCCCTGGGTCTGGGGG - Exonic
1167121662 19:47521010-47521032 TCCCTGTCCGGTGGTGCTGGAGG - Exonic
1167707685 19:51091274-51091296 ATCGTGTCTCATGGGGCTGGTGG - Intergenic
1168328344 19:55550176-55550198 TGTGTGTACCCTGGGGCTGCAGG - Intergenic
1168388489 19:55986637-55986659 TGCCTGTTCCCTGGGGCTGGTGG + Intronic
1168403050 19:56097104-56097126 TGCCTGGGCCGTGGAGCTGGGGG - Intronic
1168403161 19:56097786-56097808 TGTGTGTCCCCTGGGCCAGGTGG - Intronic
925177719 2:1796968-1796990 TGGGTGTCCCCTGGGGCCGAGGG + Intronic
926309879 2:11667819-11667841 TGATTTTCCCGTGGGTCTGGGGG - Intronic
926901148 2:17753527-17753549 TGCCTCTCCCGGGTGGCTGGGGG + Intronic
931321310 2:61177195-61177217 TGCAAGTCCCGCGGTGCTGGCGG - Intergenic
934174203 2:89564891-89564913 TGCTTGTCTGGTGGGGATGGTGG - Intergenic
934284519 2:91639240-91639262 TGCTTGTCTGGTGGGGATGGTGG - Intergenic
936623308 2:114122343-114122365 TGGGTGTCCTGTTGGGCTGCTGG + Intergenic
938764155 2:134449373-134449395 ACCGTGTGCCGTGGGGCTGGTGG + Exonic
940863975 2:158798454-158798476 TCCCTGTCCCCTGGGGCAGGAGG - Intronic
945254121 2:207789859-207789881 TGCCTGACCCCTGGGGTTGGGGG + Intergenic
946298779 2:218809322-218809344 TGCGTGTCTGGTGGAACTGGAGG - Intronic
947623624 2:231605792-231605814 TGCTTGGCCTGTTGGGCTGGGGG - Intergenic
948947516 2:241228587-241228609 TGGGTTTCCCGTGGAGCTGGGGG - Exonic
1169072980 20:2745028-2745050 TTCATGCCGCGTGGGGCTGGTGG + Intronic
1169267407 20:4174960-4174982 TGAGTGTCCCTTGGGGCAGGTGG + Intronic
1170759458 20:19236882-19236904 GGAGTGTCCCTTGGGGATGGTGG + Intronic
1170816992 20:19721881-19721903 TGGGCGTCCCCTGGGGTTGGGGG + Exonic
1172104773 20:32510437-32510459 TGCGTGCTCCGAGGGGGTGGTGG - Intronic
1172136680 20:32690892-32690914 TGGAGGTCCCGAGGGGCTGGCGG + Intergenic
1175771773 20:61628603-61628625 TGCCCGGCCTGTGGGGCTGGAGG - Intronic
1175873412 20:62218863-62218885 TCTGTGTCCCCTGGGCCTGGGGG + Intronic
1176123938 20:63466773-63466795 TGCGTGACCCGTGGGGCGTGAGG - Intronic
1176260646 20:64177785-64177807 TGCGGGTCCCATGGGGCTGAGGG - Intronic
1176548413 21:8211734-8211756 TGCGCGTGTCGTGGGGCCGGCGG + Intergenic
1176556305 21:8255940-8255962 TGCGCGTGTCGTGGGGCCGGCGG + Intergenic
1176567344 21:8394769-8394791 TGCGCGTGTCGTGGGGCCGGCGG + Intergenic
1176575244 21:8438982-8439004 TGCGCGTGTCGTGGGGCCGGCGG + Intergenic
1177505150 21:22010669-22010691 TGGGTGGCCTGTGGGGCAGGCGG - Intergenic
1180086516 21:45510144-45510166 GGCGCGGGCCGTGGGGCTGGCGG + Exonic
1180945285 22:19689129-19689151 TGCTTTTCCCTTGGGGCTTGGGG + Intergenic
1180949911 22:19716244-19716266 TGGGTGACCAGTGGGTCTGGGGG + Intronic
1181087288 22:20447056-20447078 TGCATGTCCAGTGGGAGTGGGGG - Intronic
1181361099 22:22336743-22336765 GGCCTGTCCGGGGGGGCTGGGGG + Intergenic
1182258426 22:29054656-29054678 TTGGTGTCCGATGGGGCTGGGGG + Exonic
1184114296 22:42413270-42413292 TGCCTGTGGTGTGGGGCTGGAGG + Intronic
1184207426 22:43014368-43014390 TCCGTGTCCCGGGGGGGGGGGGG - Intronic
1185089024 22:48755635-48755657 TGCGTGCCCCGTGGAGATGGGGG + Intronic
1203253295 22_KI270733v1_random:128037-128059 TGCGCGTGTCGTGGGGCCGGCGG + Intergenic
1203261350 22_KI270733v1_random:173116-173138 TGCGCGTGTCGTGGGGCCGGCGG + Intergenic
951080394 3:18445046-18445068 TGCGCGTCCCGGGTGGCTGCGGG - Intronic
951972886 3:28467619-28467641 TGTGAGTCACCTGGGGCTGGGGG - Intronic
954714184 3:52518932-52518954 TGCGTGGGCCGTGGGGCCTGGGG - Intronic
954784612 3:53083704-53083726 TGGCTGCCCGGTGGGGCTGGTGG - Intronic
962259969 3:133895906-133895928 TGCGGGGCCCGCGGGGCTGCGGG + Intergenic
962318663 3:134374095-134374117 CGCGGGTCTCTTGGGGCTGGGGG - Intronic
963880269 3:150520609-150520631 TGCTGGTCCCCTGGAGCTGGGGG - Intergenic
964790988 3:160453039-160453061 AGTGTGGCCTGTGGGGCTGGTGG + Intronic
966855477 3:184191049-184191071 TGCTGGGCCAGTGGGGCTGGTGG + Intronic
967952698 3:194853196-194853218 TGCCTGTCCCCTGGAGCAGGTGG + Intergenic
968446434 4:654558-654580 TGCGTGTCCCGTGAGTATTGGGG + Intronic
968479656 4:827474-827496 TGAGGGTCCCGTGGGCCTGGGGG + Intergenic
969535270 4:7752822-7752844 GGCGTGTCACGTGGGTCTGGTGG - Intergenic
969828057 4:9773837-9773859 TGCTTGTCTGGTGGGGATGGTGG - Intronic
970139917 4:12970794-12970816 TGCCTGTCTCTTGGGGCTGTTGG - Intergenic
973834147 4:54792453-54792475 TGCATTTCCCTTGGAGCTGGAGG - Intergenic
978829391 4:113066187-113066209 TGTGTGTTTTGTGGGGCTGGGGG - Intronic
983520047 4:168698666-168698688 TGAGTGCCCCGTGGGGCTTTTGG + Intronic
986734095 5:10655428-10655450 AGTGTGGCCGGTGGGGCTGGGGG - Intergenic
988143002 5:27267226-27267248 GGCGTGTAGCGTGGGACTGGCGG - Intergenic
993694802 5:91048513-91048535 TGTGTGTCCCCTGGAGCTGAGGG - Intronic
997297608 5:132777507-132777529 TGCGTGTCCCCTGGAGCCTGGGG + Intronic
998152299 5:139764447-139764469 TCCGTGTCCCGGGGGTCTGGCGG + Intergenic
1001228174 5:169963510-169963532 TGCATGTCCCTTAGAGCTGGAGG + Intronic
1002376412 5:178792170-178792192 TAGCTGTCCCTTGGGGCTGGCGG - Intergenic
1002723856 5:181282140-181282162 TGCCTGCCGCGGGGGGCTGGTGG + Intergenic
1003187076 6:3841280-3841302 TGCAATTCCCCTGGGGCTGGTGG + Intergenic
1003860746 6:10319652-10319674 TGAGTTTTCCGTGGGGATGGAGG + Intergenic
1006359658 6:33580070-33580092 TGGAGGTCCCGAGGGGCTGGCGG + Exonic
1007711246 6:43825729-43825751 TGCATGTCCTGAGGGGCTGGGGG + Intergenic
1017058641 6:150460208-150460230 TGTGTGTCATGTGGGGCTCGAGG - Intergenic
1017822556 6:158060057-158060079 CGGGTGCCCTGTGGGGCTGGGGG - Intronic
1018809236 6:167285517-167285539 TGACTCGCCCGTGGGGCTGGCGG + Intronic
1019348532 7:542365-542387 TGTTTGCCCCGTGGGGTTGGAGG - Intergenic
1020276923 7:6630200-6630222 TGAGTGGCCACTGGGGCTGGGGG + Intergenic
1021628347 7:22617412-22617434 TGGCAGTCACGTGGGGCTGGTGG + Intronic
1023818795 7:43969005-43969027 TGGGTCCCTCGTGGGGCTGGGGG - Intergenic
1024051709 7:45627907-45627929 TGAGTGTCCTGTGGGGTTGGAGG + Intronic
1024231558 7:47367552-47367574 TCCTTTTCCCGTGAGGCTGGTGG - Intronic
1024532868 7:50407571-50407593 TGCATGCTCTGTGGGGCTGGAGG - Intergenic
1024673876 7:51620884-51620906 TGCCTCTCCCTTGAGGCTGGAGG - Intergenic
1026952608 7:74357479-74357501 TGAGTGGCAGGTGGGGCTGGGGG + Intronic
1029743842 7:102505971-102505993 TGGGTCCCTCGTGGGGCTGGGGG - Intronic
1029761831 7:102605134-102605156 TGGGTCCCTCGTGGGGCTGGGGG - Intronic
1032002007 7:128271682-128271704 TGCTGGCCCCGCGGGGCTGGTGG + Intergenic
1032087227 7:128890700-128890722 TGGGTGTCGTGGGGGGCTGGGGG + Intronic
1032673117 7:134104108-134104130 TGAGGGTCCCATGTGGCTGGTGG + Intergenic
1033862303 7:145643641-145643663 TTCCTGTCCCATGGGGGTGGTGG + Intergenic
1034198048 7:149262711-149262733 CTACTGTCCCGTGGGGCTGGCGG - Intronic
1035432098 7:158829788-158829810 AGGGTGCCCCGTGGGGCTCGAGG - Intronic
1035677749 8:1467257-1467279 TGAGGGTGCAGTGGGGCTGGGGG - Intergenic
1044540572 8:93404431-93404453 TGTCTGTCCAGTGGGGGTGGAGG + Intergenic
1045683410 8:104686840-104686862 TGTGTGTGTCGTGGGGGTGGGGG + Intronic
1049427566 8:142544193-142544215 TGGGTGGCCCGTGGTGCAGGAGG - Intronic
1051116195 9:13697463-13697485 TGTGTGTGCAGTGGTGCTGGTGG + Intergenic
1056580320 9:87885006-87885028 TGCATTTCCCATGCGGCTGGTGG - Exonic
1057429292 9:94979732-94979754 TCCATGCCCCGTGGGGCAGGTGG + Intronic
1061037242 9:128120658-128120680 TGAGTGCTGCGTGGGGCTGGCGG - Intergenic
1061500994 9:131001775-131001797 AGCGGGCCCCGTGGTGCTGGTGG - Intergenic
1061804169 9:133128883-133128905 GGACTGACCCGTGGGGCTGGGGG + Intronic
1062414189 9:136439599-136439621 TGGGAGCCCCGAGGGGCTGGCGG - Exonic
1062648551 9:137563668-137563690 TGGGTGGCCCGAGAGGCTGGTGG + Intronic
1062696568 9:137878815-137878837 CGGGTGTGCCGAGGGGCTGGCGG + Intronic
1203469695 Un_GL000220v1:111184-111206 TGCGCGTGTCGTGGGGCCGGCGG + Intergenic
1203477516 Un_GL000220v1:155156-155178 TGCGCGTGTCGTGGGGCCGGCGG + Intergenic
1190540593 X:51473847-51473869 AGCTTGTCACATGGGGCTGGGGG + Intergenic