ID: 1121615029

View in Genome Browser
Species Human (GRCh38)
Location 14:95307977-95307999
Sequence CAGCCTTAAATGACATAATG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 164}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121615017_1121615029 30 Left 1121615017 14:95307924-95307946 CCCTCTGACCTCGGAGTCTGCAT 0: 1
1: 0
2: 0
3: 14
4: 113
Right 1121615029 14:95307977-95307999 CAGCCTTAAATGACATAATGGGG 0: 1
1: 0
2: 2
3: 9
4: 164
1121615024_1121615029 -7 Left 1121615024 14:95307961-95307983 CCCCAGAGGTTTACGTCAGCCTT 0: 1
1: 0
2: 0
3: 5
4: 79
Right 1121615029 14:95307977-95307999 CAGCCTTAAATGACATAATGGGG 0: 1
1: 0
2: 2
3: 9
4: 164
1121615018_1121615029 29 Left 1121615018 14:95307925-95307947 CCTCTGACCTCGGAGTCTGCATC 0: 1
1: 0
2: 1
3: 8
4: 137
Right 1121615029 14:95307977-95307999 CAGCCTTAAATGACATAATGGGG 0: 1
1: 0
2: 2
3: 9
4: 164
1121615025_1121615029 -8 Left 1121615025 14:95307962-95307984 CCCAGAGGTTTACGTCAGCCTTA 0: 1
1: 0
2: 0
3: 4
4: 59
Right 1121615029 14:95307977-95307999 CAGCCTTAAATGACATAATGGGG 0: 1
1: 0
2: 2
3: 9
4: 164
1121615019_1121615029 22 Left 1121615019 14:95307932-95307954 CCTCGGAGTCTGCATCTGTGAAG 0: 1
1: 0
2: 3
3: 27
4: 337
Right 1121615029 14:95307977-95307999 CAGCCTTAAATGACATAATGGGG 0: 1
1: 0
2: 2
3: 9
4: 164
1121615026_1121615029 -9 Left 1121615026 14:95307963-95307985 CCAGAGGTTTACGTCAGCCTTAA 0: 1
1: 0
2: 0
3: 2
4: 63
Right 1121615029 14:95307977-95307999 CAGCCTTAAATGACATAATGGGG 0: 1
1: 0
2: 2
3: 9
4: 164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121615029 Original CRISPR CAGCCTTAAATGACATAATG GGG Intronic
903976037 1:27150892-27150914 CTGCCATAGATGACAGAATGAGG + Intronic
904585791 1:31579828-31579850 AAGCCTTAATAGAAATAATGGGG + Intronic
910533560 1:88269650-88269672 AAGAATTAAATGAGATAATGTGG + Intergenic
912542614 1:110428581-110428603 CAGTCTTAAATAAGAAAATGGGG - Intergenic
913048337 1:115092320-115092342 CTACATTAAATGACATAATAAGG + Intergenic
913253783 1:116935878-116935900 CAGCCTTAAAAGTCCTATTGAGG - Intronic
915848669 1:159297507-159297529 CAGCATAAAATGAGTTAATGTGG - Intronic
915857655 1:159406743-159406765 GAGCCTTTGATGACACAATGAGG + Intergenic
916120012 1:161521032-161521054 AAGACCTAAAGGACATAATGAGG - Intronic
916129767 1:161602681-161602703 AAGACCTAAAGGACATAATGAGG - Intronic
917421062 1:174864287-174864309 CAGCTTTATATGTCATAGTGGGG - Intronic
918357028 1:183714549-183714571 GGGGCTTAAATTACATAATGAGG - Intronic
921035340 1:211372546-211372568 CAGCTTTAAAAGACCTGATGGGG + Exonic
923013428 1:230107130-230107152 CAATCTTAAATGTCATAGTGAGG + Intronic
1063680635 10:8184397-8184419 TCCCATTAAATGACATAATGAGG + Intergenic
1063935073 10:11068858-11068880 TTGCCTTAAAAGAAATAATGAGG - Intronic
1066752784 10:38676146-38676168 CAGGATTAAATGACAGAATCTGG + Intergenic
1072244323 10:93528355-93528377 CAGGCTGCAATGACAGAATGTGG + Exonic
1074699877 10:116083527-116083549 CAGGATTAGCTGACATAATGGGG + Intronic
1075911815 10:126131532-126131554 CAGGCTTAGATGAGATCATGAGG + Intronic
1076067482 10:127460145-127460167 CAGCCTTCAATGAAAAAGTGTGG + Intergenic
1076586752 10:131553946-131553968 CAGGCTTGAATGACAAAATCTGG + Intergenic
1077747841 11:4927497-4927519 CTGCCTTGACTGACATGATGAGG + Intronic
1078896100 11:15598518-15598540 GGGCCTAAAATGACAAAATGAGG + Intergenic
1081996147 11:47365445-47365467 TAGGATTAAATGAGATAATGTGG - Intronic
1087094038 11:94303475-94303497 TAACGTTAAATGCCATAATGAGG - Intergenic
1087518400 11:99197890-99197912 CAGAAATAAATGACATAATTTGG + Intronic
1089065882 11:115661657-115661679 CCACATTAAATGACATAATGTGG - Intergenic
1089664728 11:120011002-120011024 CAGCGCTAAATGACATACTTTGG + Intergenic
1090912157 11:131130538-131130560 CAGCCCTAAAGAACATCATGAGG + Intergenic
1094172789 12:27511483-27511505 CAGCCAAAAATGAGATAAAGAGG + Intergenic
1095266348 12:40162979-40163001 CATCCAAAAATGACATAATTTGG - Intergenic
1099515921 12:83596638-83596660 CAGCCATAAATGACTGCATGAGG + Intergenic
1103199379 12:119074269-119074291 AAGCATTGAATGAGATAATGTGG - Intronic
1109173201 13:59121487-59121509 TAGCCTTAAATCACATAACAAGG - Intergenic
1110591284 13:77263811-77263833 CAGCATTACATTACATAAAGAGG + Intronic
1110974494 13:81812560-81812582 CAGCATTAATTGACATCATATGG - Intergenic
1111940673 13:94603273-94603295 CTGTCTTAAATGGCACAATGTGG + Intronic
1112367656 13:98769448-98769470 CTGCCTTTCTTGACATAATGAGG - Intergenic
1116906924 14:50413205-50413227 GAGGATTAAAGGACATAATGTGG - Intronic
1118052069 14:62040212-62040234 CAGCCTAAAATGAAGGAATGTGG + Intronic
1121615029 14:95307977-95307999 CAGCCTTAAATGACATAATGGGG + Intronic
1122474465 14:101997126-101997148 GAGCCTTCAATGACATCATGCGG + Exonic
1128199683 15:65793667-65793689 CAGCTTTAACTGACATACAGAGG - Intronic
1135734691 16:24921283-24921305 CAGCCCTAAAATACCTAATGAGG - Intronic
1138188899 16:54998287-54998309 CAGCCTTAATTTTCATAAAGGGG - Intergenic
1139369972 16:66460928-66460950 GAGGATTAAATGAGATAATGTGG + Intronic
1140280206 16:73546909-73546931 GGGCCTGAAATGACAGAATGAGG - Intergenic
1141313519 16:82938423-82938445 CAGCCTTAGATGAGATAATGAGG + Intronic
1144221508 17:13104150-13104172 CAGCCTTAAATAAAGGAATGAGG - Intergenic
1145245601 17:21267272-21267294 CAGCCATAAAAGACATTTTGGGG + Intergenic
1149935300 17:60799453-60799475 CAGTCTTGAATGACAAAATAAGG - Intronic
1150210973 17:63441318-63441340 CACCCTTAAATGACACTGTGTGG + Intronic
1150897205 17:69226028-69226050 CAACCTTAAAAGACATTTTGGGG + Intronic
1150984938 17:70185309-70185331 CAACCATATATGACAAAATGAGG + Intergenic
1152060029 17:78065547-78065569 CAGGTTTAAATTACTTAATGTGG - Intronic
1155317264 18:24584490-24584512 CAGCCTCAAATGCCAGGATGAGG + Intergenic
1157037778 18:43996988-43997010 CAGCCTTAAAGGTCATACTTAGG - Intergenic
1157729973 18:49994920-49994942 CAGCATTAAATGAGATTATAAGG - Intronic
1158596739 18:58823235-58823257 CAGCCTTAAAAAAAAAAATGCGG - Intergenic
1159156975 18:64596777-64596799 CAACCTTAAATGAGGTAATCTGG - Intergenic
1159507471 18:69355924-69355946 CAGGCTTATAAGACATCATGTGG - Intergenic
1163912521 19:20209661-20209683 GAGAATTAAATTACATAATGAGG - Intergenic
1164927835 19:32144109-32144131 CATCCTTAAATGTCCTAATGAGG + Intergenic
1167298582 19:48665968-48665990 GAGGCTTAAATGAGATAAAGTGG + Intronic
1168586247 19:57595376-57595398 CAGCATTGAATGACAAGATGTGG - Intergenic
925226551 2:2188484-2188506 GTCCCTTAAATGACATAATTTGG - Intronic
928124483 2:28606244-28606266 GAGCCTTAAATGAGATAACGTGG - Intronic
931760333 2:65411177-65411199 GAGGATTAAATGAGATAATGTGG - Intronic
934245222 2:90299679-90299701 CTGCCTTAAATGATTTCATGGGG + Intergenic
935432932 2:102996683-102996705 CAGTCTGAAATTACATAAAGTGG + Intergenic
936615445 2:114043269-114043291 CAACCTTAAAAGACATCAGGAGG - Intergenic
936852750 2:116920631-116920653 AAGCCTCAAATGAAATAGTGTGG + Intergenic
937594243 2:123654409-123654431 CAGCTTTAAATGACATACTAAGG - Intergenic
938986967 2:136585826-136585848 CACCCATAAAAGTCATAATGAGG + Intergenic
942729278 2:179045812-179045834 CAGCCAAAAAACACATAATGGGG + Intronic
942783541 2:179673865-179673887 CTGCTGTAAATGAAATAATGTGG - Intronic
943688975 2:190849703-190849725 CAACCTTAAAGGAGAGAATGAGG + Intergenic
946502556 2:220265243-220265265 GAGGATTAAATGAAATAATGAGG - Intergenic
1168834383 20:868419-868441 CATCCTTAAATGAGAAGATGAGG - Intergenic
1169525119 20:6416207-6416229 CACACTTAAATGGCATATTGAGG + Intergenic
1170765904 20:19289965-19289987 CAGCCTTAGGTCACATAATCTGG + Intronic
1172698450 20:36837876-36837898 GAGGATTAAATGAAATAATGCGG - Intronic
1172949139 20:38711197-38711219 GAGGATTAAATGAGATAATGTGG - Intergenic
1174293801 20:49529335-49529357 CACGTATAAATGACATAATGCGG + Intronic
1174528567 20:51192942-51192964 CAGCCTGAAAAGACATGGTGAGG - Intergenic
1175166148 20:57046251-57046273 CAGCCTGGACTGACAGAATGAGG - Intergenic
1175663505 20:60838120-60838142 CAGCCTTGAAGGTCACAATGAGG + Intergenic
1183171167 22:36189391-36189413 CACCCTTAAATAACCTAAAGGGG + Exonic
1184626753 22:45739750-45739772 GAGGGTTAAATGAGATAATGTGG + Intronic
1185096578 22:48809666-48809688 CAACCTGACATGACATAATTTGG - Intronic
950284848 3:11736695-11736717 CAGCATTAAATGAGATAAACTGG - Intergenic
954495501 3:50955908-50955930 CATCCTCAAAGGACATAAAGAGG - Intronic
955594015 3:60569009-60569031 CAGCCTTAGAAGACATAAAATGG - Intronic
956669973 3:71679027-71679049 CAGACTTTAATCAGATAATGTGG - Exonic
956672807 3:71707187-71707209 GAGACTTAAATGATACAATGAGG - Intronic
959412473 3:106042299-106042321 CAGCTTAAAATAAGATAATGTGG + Intergenic
964659616 3:159105824-159105846 CAGCCGTATAGGACATGATGAGG + Intronic
966094203 3:176178874-176178896 AAGCCTTAAATGACAGAATGAGG - Intergenic
966657682 3:182377824-182377846 AAGGATTAAATGACATAATGGGG + Intergenic
968937901 4:3622904-3622926 GAGAATTAAATGAGATAATGCGG + Intergenic
970186249 4:13456627-13456649 AAGTATTAAATGAAATAATGAGG - Intronic
973782063 4:54297557-54297579 GAGCCTTGCATGACATCATGAGG + Exonic
974957425 4:68659385-68659407 CATCCAAAAATGACATAATTTGG + Intronic
975465095 4:74699782-74699804 AATTCTTAACTGACATAATGTGG + Intergenic
981224817 4:142281704-142281726 GAGCTTTAAATTACACAATGAGG + Intronic
984125675 4:175807079-175807101 CAGACTTCAATGACATATTAAGG + Intronic
984563286 4:181296665-181296687 CAGTCTTAAATGAGATGATGGGG - Intergenic
985116703 4:186599087-186599109 CATCCCTAAGTGACAAAATGAGG + Intronic
989762284 5:45030834-45030856 CATCTTTAGATGACAGAATGAGG + Intergenic
992208738 5:74456500-74456522 GAAGATTAAATGACATAATGTGG - Intergenic
992997744 5:82349083-82349105 CAGCCTTAGATGCCATGAAGGGG - Intronic
994278484 5:97869377-97869399 TAGACTTAGATGACATCATGAGG - Intergenic
994833294 5:104814022-104814044 CAGACTAAAAGGACATATTGTGG - Intergenic
996626461 5:125575908-125575930 TAGCCTGAAATGACATCAAGGGG - Intergenic
997510178 5:134448618-134448640 AAGCCTTAAATGACAGACTGAGG - Intergenic
997878720 5:137571258-137571280 CATCCTTAAATGAGATAAAATGG + Intronic
997894135 5:137700953-137700975 AAGGGTTAAATGAAATAATGTGG - Intronic
999511310 5:152255582-152255604 CAGGCAGAAATGACAGAATGGGG - Intergenic
1000921986 5:167149178-167149200 CAGCCTTAAATGAAAATATTAGG - Intergenic
1001655614 5:173346834-173346856 CAACCTTAAATAACACCATGGGG - Intergenic
1002441548 5:179267006-179267028 CAGCCTTGAATGACCCAAGGTGG - Intronic
1007519803 6:42442782-42442804 CAGCATTAAATAAAAGAATGTGG - Intronic
1008980422 6:57476911-57476933 AAGTTTTAAATCACATAATGAGG - Intronic
1009168528 6:60369855-60369877 AAGTTTTAAATCACATAATGAGG - Intergenic
1010314783 6:74435345-74435367 AAGCCTTAGAAGACAGAATGAGG + Intergenic
1010355327 6:74925837-74925859 CAGCCTGAAATGACCCACTGGGG - Intergenic
1010866944 6:80987689-80987711 CAGAAATAAAAGACATAATGGGG + Intergenic
1012428489 6:99141040-99141062 AAGCCTCAAATGAGAAAATGAGG + Intergenic
1012666591 6:101978452-101978474 CAGAATTAAATGATATGATGAGG - Intronic
1013444014 6:110202851-110202873 CAGCCTAAAATAAAATAAAGTGG + Intronic
1014751206 6:125258495-125258517 CAGCCTTAGACGACCCAATGAGG + Intronic
1014817199 6:125949212-125949234 AAGCCTTAAAAGCCATCATGTGG + Intergenic
1021395215 7:20139172-20139194 CAGCCTTAATGGCCCTAATGTGG + Exonic
1023214230 7:37844627-37844649 TAGTCTTAAATGAATTAATGTGG - Intronic
1023534222 7:41191181-41191203 CAGGTTTAAGTGACATCATGAGG + Intergenic
1024758784 7:52568706-52568728 CAGTCTCAAATGACAGAATGAGG - Intergenic
1026227702 7:68457264-68457286 CAGCCTTTAAAGACAGAAGGAGG + Intergenic
1026316765 7:69234006-69234028 CTTCCTTCAATGAAATAATGGGG + Intergenic
1028264957 7:88711819-88711841 GATCCTTAAATGTCAGAATGGGG + Intergenic
1028894536 7:96026540-96026562 AAGCCTTGAATGACATTATTTGG - Intronic
1030574890 7:111273395-111273417 TAGCCTTATTTGACATAATAAGG + Intronic
1030636095 7:111950780-111950802 CAGCATTAAATGGAATAATCTGG - Intronic
1030875567 7:114809319-114809341 AAACCTTAAATGACACAATTTGG - Intergenic
1031067768 7:117124781-117124803 CAGCATTAAATGAGGTCATGTGG + Intronic
1032669603 7:134071128-134071150 GAGGATTAAATGAAATAATGTGG - Intergenic
1034934283 7:155188451-155188473 CAGCCTCAAACGACAGGATGTGG + Intergenic
1035116322 7:156527362-156527384 GATCATTAAATGAGATAATGTGG - Intergenic
1035446397 7:158945817-158945839 CAGATTTAAAAGACATAAGGTGG + Exonic
1035969667 8:4233913-4233935 CACCCTAAAATGCCTTAATGAGG + Intronic
1041100735 8:54394426-54394448 CATCCTTAAATGACACAGAGTGG + Intergenic
1042454161 8:68980715-68980737 CAGTCTTTAATGACCTAATAAGG - Intergenic
1044562355 8:93625558-93625580 TAGCCTAAAATGACATGATTTGG + Intergenic
1045777549 8:105823594-105823616 CACCCTTAAATGTCTTAATCTGG + Intergenic
1046414622 8:113896567-113896589 GACCCTTAAATAAAATAATGTGG - Intergenic
1047350728 8:124071181-124071203 CAGGATTGAATGAGATAATGGGG + Intronic
1047894831 8:129355032-129355054 GAGGGTTAAATGAGATAATGCGG - Intergenic
1048030725 8:130629130-130629152 CAGTCTTAGAGGACAGAATGTGG - Intergenic
1048479659 8:134776994-134777016 CATCCTTAAATGAGAATATGTGG - Intergenic
1048735339 8:137493423-137493445 CATCCTAATATGATATAATGGGG - Intergenic
1051099683 9:13506525-13506547 CACACTGAAATGCCATAATGGGG - Intergenic
1055751386 9:79509780-79509802 CAGACTGAAATGTCATTATGTGG - Intergenic
1057131500 9:92657422-92657444 CCTCTGTAAATGACATAATGTGG - Intronic
1058764597 9:108169201-108169223 CATCCATAAATTACATATTGAGG - Intergenic
1059658842 9:116381343-116381365 CAGCCTTAAATGAGGTGATTGGG + Intronic
1060291561 9:122307620-122307642 GAGGATTAAATGAAATAATGGGG - Intronic
1060490205 9:124078549-124078571 CAGCCTTAAATGACACTGTTTGG + Intergenic
1061788689 9:133046692-133046714 GAGCCTTAAAGGAGATCATGGGG + Intronic
1187356306 X:18575522-18575544 CAGCCTTAAATAAAAGAATCGGG - Intronic
1188759088 X:34003180-34003202 AAGCCTTGAATGAGATATTGAGG - Intergenic
1189261100 X:39679415-39679437 CAGCCTCAAATGCCAATATGAGG - Intergenic
1190471339 X:50782477-50782499 GAGGATTAAATGAGATAATGTGG - Intronic
1194848265 X:98838981-98839003 CAGCCTCAAATGACCAACTGGGG - Intergenic
1197400607 X:125984442-125984464 CAGCCTGAAATGACTGAAAGAGG + Intergenic
1201666254 Y:16459374-16459396 CATCCTTAAGTGACATTAGGTGG + Intergenic
1201706205 Y:16939956-16939978 CTGCCTTAAAAGACAGGATGAGG + Intergenic