ID: 1121618789

View in Genome Browser
Species Human (GRCh38)
Location 14:95332002-95332024
Sequence AGGCTCCATCCTGTCTGTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121618789_1121618797 22 Left 1121618789 14:95332002-95332024 CCAAGACAGACAGGATGGAGCCT No data
Right 1121618797 14:95332047-95332069 CACCACAGTCGTTGCAGTCTGGG No data
1121618789_1121618792 -4 Left 1121618789 14:95332002-95332024 CCAAGACAGACAGGATGGAGCCT No data
Right 1121618792 14:95332021-95332043 GCCTCTTCCTTAGGGCCTTGAGG No data
1121618789_1121618798 23 Left 1121618789 14:95332002-95332024 CCAAGACAGACAGGATGGAGCCT No data
Right 1121618798 14:95332048-95332070 ACCACAGTCGTTGCAGTCTGGGG No data
1121618789_1121618796 21 Left 1121618789 14:95332002-95332024 CCAAGACAGACAGGATGGAGCCT No data
Right 1121618796 14:95332046-95332068 TCACCACAGTCGTTGCAGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121618789 Original CRISPR AGGCTCCATCCTGTCTGTCT TGG (reversed) Intergenic