ID: 1121618793

View in Genome Browser
Species Human (GRCh38)
Location 14:95332022-95332044
Sequence GCCTCAAGGCCCTAAGGAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121618793_1121618800 27 Left 1121618793 14:95332022-95332044 CCTCTTCCTTAGGGCCTTGAGGC No data
Right 1121618800 14:95332072-95332094 CTATTGAACCAGACTGACTCTGG No data
1121618793_1121618796 1 Left 1121618793 14:95332022-95332044 CCTCTTCCTTAGGGCCTTGAGGC No data
Right 1121618796 14:95332046-95332068 TCACCACAGTCGTTGCAGTCTGG No data
1121618793_1121618798 3 Left 1121618793 14:95332022-95332044 CCTCTTCCTTAGGGCCTTGAGGC No data
Right 1121618798 14:95332048-95332070 ACCACAGTCGTTGCAGTCTGGGG No data
1121618793_1121618797 2 Left 1121618793 14:95332022-95332044 CCTCTTCCTTAGGGCCTTGAGGC No data
Right 1121618797 14:95332047-95332069 CACCACAGTCGTTGCAGTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121618793 Original CRISPR GCCTCAAGGCCCTAAGGAAG AGG (reversed) Intergenic