ID: 1121618794

View in Genome Browser
Species Human (GRCh38)
Location 14:95332028-95332050
Sequence GGTGAAGCCTCAAGGCCCTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121618794_1121618796 -5 Left 1121618794 14:95332028-95332050 CCTTAGGGCCTTGAGGCTTCACC No data
Right 1121618796 14:95332046-95332068 TCACCACAGTCGTTGCAGTCTGG No data
1121618794_1121618801 27 Left 1121618794 14:95332028-95332050 CCTTAGGGCCTTGAGGCTTCACC No data
Right 1121618801 14:95332078-95332100 AACCAGACTGACTCTGGTCCTGG No data
1121618794_1121618797 -4 Left 1121618794 14:95332028-95332050 CCTTAGGGCCTTGAGGCTTCACC No data
Right 1121618797 14:95332047-95332069 CACCACAGTCGTTGCAGTCTGGG No data
1121618794_1121618798 -3 Left 1121618794 14:95332028-95332050 CCTTAGGGCCTTGAGGCTTCACC No data
Right 1121618798 14:95332048-95332070 ACCACAGTCGTTGCAGTCTGGGG No data
1121618794_1121618800 21 Left 1121618794 14:95332028-95332050 CCTTAGGGCCTTGAGGCTTCACC No data
Right 1121618800 14:95332072-95332094 CTATTGAACCAGACTGACTCTGG No data
1121618794_1121618803 30 Left 1121618794 14:95332028-95332050 CCTTAGGGCCTTGAGGCTTCACC No data
Right 1121618803 14:95332081-95332103 CAGACTGACTCTGGTCCTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121618794 Original CRISPR GGTGAAGCCTCAAGGCCCTA AGG (reversed) Intergenic