ID: 1121618795

View in Genome Browser
Species Human (GRCh38)
Location 14:95332036-95332058
Sequence ACGACTGTGGTGAAGCCTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121618795_1121618800 13 Left 1121618795 14:95332036-95332058 CCTTGAGGCTTCACCACAGTCGT No data
Right 1121618800 14:95332072-95332094 CTATTGAACCAGACTGACTCTGG No data
1121618795_1121618801 19 Left 1121618795 14:95332036-95332058 CCTTGAGGCTTCACCACAGTCGT No data
Right 1121618801 14:95332078-95332100 AACCAGACTGACTCTGGTCCTGG No data
1121618795_1121618804 23 Left 1121618795 14:95332036-95332058 CCTTGAGGCTTCACCACAGTCGT No data
Right 1121618804 14:95332082-95332104 AGACTGACTCTGGTCCTGGAGGG No data
1121618795_1121618803 22 Left 1121618795 14:95332036-95332058 CCTTGAGGCTTCACCACAGTCGT No data
Right 1121618803 14:95332081-95332103 CAGACTGACTCTGGTCCTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121618795 Original CRISPR ACGACTGTGGTGAAGCCTCA AGG (reversed) Intergenic