ID: 1121618797

View in Genome Browser
Species Human (GRCh38)
Location 14:95332047-95332069
Sequence CACCACAGTCGTTGCAGTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121618793_1121618797 2 Left 1121618793 14:95332022-95332044 CCTCTTCCTTAGGGCCTTGAGGC No data
Right 1121618797 14:95332047-95332069 CACCACAGTCGTTGCAGTCTGGG No data
1121618794_1121618797 -4 Left 1121618794 14:95332028-95332050 CCTTAGGGCCTTGAGGCTTCACC No data
Right 1121618797 14:95332047-95332069 CACCACAGTCGTTGCAGTCTGGG No data
1121618789_1121618797 22 Left 1121618789 14:95332002-95332024 CCAAGACAGACAGGATGGAGCCT No data
Right 1121618797 14:95332047-95332069 CACCACAGTCGTTGCAGTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121618797 Original CRISPR CACCACAGTCGTTGCAGTCT GGG Intergenic