ID: 1121618799

View in Genome Browser
Species Human (GRCh38)
Location 14:95332049-95332071
Sequence TCCCCAGACTGCAACGACTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121618799_1121618801 6 Left 1121618799 14:95332049-95332071 CCACAGTCGTTGCAGTCTGGGGA No data
Right 1121618801 14:95332078-95332100 AACCAGACTGACTCTGGTCCTGG No data
1121618799_1121618803 9 Left 1121618799 14:95332049-95332071 CCACAGTCGTTGCAGTCTGGGGA No data
Right 1121618803 14:95332081-95332103 CAGACTGACTCTGGTCCTGGAGG No data
1121618799_1121618805 19 Left 1121618799 14:95332049-95332071 CCACAGTCGTTGCAGTCTGGGGA No data
Right 1121618805 14:95332091-95332113 CTGGTCCTGGAGGGTGACCGTGG No data
1121618799_1121618800 0 Left 1121618799 14:95332049-95332071 CCACAGTCGTTGCAGTCTGGGGA No data
Right 1121618800 14:95332072-95332094 CTATTGAACCAGACTGACTCTGG No data
1121618799_1121618804 10 Left 1121618799 14:95332049-95332071 CCACAGTCGTTGCAGTCTGGGGA No data
Right 1121618804 14:95332082-95332104 AGACTGACTCTGGTCCTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121618799 Original CRISPR TCCCCAGACTGCAACGACTG TGG (reversed) Intergenic