ID: 1121618800

View in Genome Browser
Species Human (GRCh38)
Location 14:95332072-95332094
Sequence CTATTGAACCAGACTGACTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121618795_1121618800 13 Left 1121618795 14:95332036-95332058 CCTTGAGGCTTCACCACAGTCGT No data
Right 1121618800 14:95332072-95332094 CTATTGAACCAGACTGACTCTGG No data
1121618794_1121618800 21 Left 1121618794 14:95332028-95332050 CCTTAGGGCCTTGAGGCTTCACC No data
Right 1121618800 14:95332072-95332094 CTATTGAACCAGACTGACTCTGG No data
1121618799_1121618800 0 Left 1121618799 14:95332049-95332071 CCACAGTCGTTGCAGTCTGGGGA No data
Right 1121618800 14:95332072-95332094 CTATTGAACCAGACTGACTCTGG No data
1121618793_1121618800 27 Left 1121618793 14:95332022-95332044 CCTCTTCCTTAGGGCCTTGAGGC No data
Right 1121618800 14:95332072-95332094 CTATTGAACCAGACTGACTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121618800 Original CRISPR CTATTGAACCAGACTGACTC TGG Intergenic