ID: 1121621429

View in Genome Browser
Species Human (GRCh38)
Location 14:95352056-95352078
Sequence CTCTCTCTCTGCTTTCTGAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121621425_1121621429 12 Left 1121621425 14:95352021-95352043 CCAAAAGCTTCCTTGGGCTACTT No data
Right 1121621429 14:95352056-95352078 CTCTCTCTCTGCTTTCTGATTGG No data
1121621423_1121621429 14 Left 1121621423 14:95352019-95352041 CCCCAAAAGCTTCCTTGGGCTAC No data
Right 1121621429 14:95352056-95352078 CTCTCTCTCTGCTTTCTGATTGG No data
1121621421_1121621429 18 Left 1121621421 14:95352015-95352037 CCATCCCCAAAAGCTTCCTTGGG No data
Right 1121621429 14:95352056-95352078 CTCTCTCTCTGCTTTCTGATTGG No data
1121621426_1121621429 2 Left 1121621426 14:95352031-95352053 CCTTGGGCTACTTTGAAAGCCAT No data
Right 1121621429 14:95352056-95352078 CTCTCTCTCTGCTTTCTGATTGG No data
1121621424_1121621429 13 Left 1121621424 14:95352020-95352042 CCCAAAAGCTTCCTTGGGCTACT No data
Right 1121621429 14:95352056-95352078 CTCTCTCTCTGCTTTCTGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121621429 Original CRISPR CTCTCTCTCTGCTTTCTGAT TGG Intergenic