ID: 1121624046

View in Genome Browser
Species Human (GRCh38)
Location 14:95371740-95371762
Sequence GTCCTCCCACGAGTGAGCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121624046_1121624054 21 Left 1121624046 14:95371740-95371762 CCCAAGCTCACTCGTGGGAGGAC No data
Right 1121624054 14:95371784-95371806 CTGCCGCCTTCTTTGGGACCCGG No data
1121624046_1121624057 27 Left 1121624046 14:95371740-95371762 CCCAAGCTCACTCGTGGGAGGAC No data
Right 1121624057 14:95371790-95371812 CCTTCTTTGGGACCCGGAATAGG No data
1121624046_1121624052 14 Left 1121624046 14:95371740-95371762 CCCAAGCTCACTCGTGGGAGGAC No data
Right 1121624052 14:95371777-95371799 TCAATGACTGCCGCCTTCTTTGG No data
1121624046_1121624053 15 Left 1121624046 14:95371740-95371762 CCCAAGCTCACTCGTGGGAGGAC No data
Right 1121624053 14:95371778-95371800 CAATGACTGCCGCCTTCTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121624046 Original CRISPR GTCCTCCCACGAGTGAGCTT GGG (reversed) Intergenic
No off target data available for this crispr