ID: 1121626154

View in Genome Browser
Species Human (GRCh38)
Location 14:95386756-95386778
Sequence CACAGGAGGGAGCAGCCCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121626154_1121626164 22 Left 1121626154 14:95386756-95386778 CCCTGGGGCTGCTCCCTCCTGTG No data
Right 1121626164 14:95386801-95386823 TTCCTGTCTACCAGCCCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121626154 Original CRISPR CACAGGAGGGAGCAGCCCCA GGG (reversed) Intergenic
No off target data available for this crispr