ID: 1121629036

View in Genome Browser
Species Human (GRCh38)
Location 14:95409211-95409233
Sequence CCTCAGAGCAGCCAGCTAGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 267
Summary {0: 1, 1: 1, 2: 0, 3: 21, 4: 244}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121629036_1121629040 5 Left 1121629036 14:95409211-95409233 CCGCCTAGCTGGCTGCTCTGAGG 0: 1
1: 1
2: 0
3: 21
4: 244
Right 1121629040 14:95409239-95409261 TGCTGACCCTCTCCACACTCTGG 0: 1
1: 0
2: 1
3: 22
4: 174

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121629036 Original CRISPR CCTCAGAGCAGCCAGCTAGG CGG (reversed) Intronic
900168722 1:1255785-1255807 GTTCTGAGCAGCCAGCTGGGTGG - Intronic
900568410 1:3346647-3346669 CCTCCTTGCAGCCAGCTTGGAGG - Intronic
901008172 1:6181564-6181586 CCACAGAGCAGCTAGCCAGGGGG + Intronic
902282530 1:15384834-15384856 CCTCACATCAGCCTGCGAGGAGG + Intronic
902702035 1:18179097-18179119 GCTCAGAGAAGCCAGCTGTGGGG + Intronic
902740446 1:18434211-18434233 TCCCAGAGCAGCCAGGAAGGAGG + Intergenic
903022418 1:20403612-20403634 CCCCAGAGAAGCCAGGCAGGTGG + Intergenic
903163251 1:21504008-21504030 GCTCAGAGCTGACTGCTAGGAGG + Intergenic
903777691 1:25803647-25803669 CCCCAGATCATACAGCTAGGTGG + Intronic
905119124 1:35668332-35668354 CCTCTGACCATCCAGGTAGGAGG - Intergenic
907515372 1:54990366-54990388 CCTCACAGCAGCCTGCTGGGAGG - Intronic
909909245 1:81241437-81241459 CCTCAGAGCAGCAAGATAAGAGG - Intergenic
910261962 1:85302027-85302049 CCTCAGGACAGCCAGCAATGAGG - Intergenic
911751188 1:101499878-101499900 CCTCAGAGAAGAGAGGTAGGAGG - Intergenic
918139142 1:181705624-181705646 CCTCAGAGGAGCCAGGTTTGGGG + Intronic
918984680 1:191608701-191608723 CCTCTCAGCAGCCAGCTTTGTGG - Intergenic
920664657 1:207954089-207954111 CCTCAGAGCTTCCAGGTAAGAGG - Intergenic
922785216 1:228279262-228279284 CCTCAGTGCGGCCACCTAAGTGG + Exonic
1063859311 10:10290716-10290738 CCTCAGAGAAGAGAGCCAGGAGG + Intergenic
1064123411 10:12638628-12638650 CCTCAGAGTAGCCTGCTGGCTGG + Intronic
1066642256 10:37566455-37566477 CCTCAGAGCAGCCATTTCAGTGG - Intergenic
1067079400 10:43204772-43204794 CCCCAGAGGAGCCACCTTGGCGG - Intronic
1069602635 10:69717801-69717823 GCTCAGAGCAGCCATCCTGGGGG - Intergenic
1070915619 10:80152704-80152726 CCTCTCAGCAGCCAGCTCTGTGG + Exonic
1070918889 10:80171767-80171789 CCTCTGAGCAGCAAGAGAGGAGG - Intronic
1073103885 10:101021413-101021435 CCCCAGGGCATACAGCTAGGAGG - Intronic
1076287226 10:129312117-129312139 CGTCAGAGCAGGCTGCTTGGGGG - Intergenic
1076354693 10:129843129-129843151 CCTCACAACAACCAGGTAGGTGG - Exonic
1081085273 11:38791738-38791760 CCTCTGGGCACCCAGCTAGTGGG - Intergenic
1081775765 11:45675020-45675042 CCACAGGGCAGCCAGGGAGGAGG + Intergenic
1083297550 11:61723208-61723230 GCTCAGAGCAGGCAGCTCTGTGG - Intronic
1083312247 11:61790037-61790059 GCTCAGAGCAGCCAGGCAGAGGG + Intronic
1083772492 11:64876198-64876220 TCTTAGAGCAGCCACATAGGGGG + Intronic
1084322188 11:68379509-68379531 GCTCAGAGCTGCCAGTGAGGTGG - Intronic
1088223402 11:107591892-107591914 CCTCCGCGCAGCGAGCTGGGAGG + Intronic
1090427298 11:126617048-126617070 CATCAGAGCAGGCAGGTTGGAGG + Intronic
1090450196 11:126799642-126799664 CCTTAGAGCAGGGAGCCAGGAGG + Intronic
1091082899 11:132689054-132689076 CCTCAGGGCAGGCAGCTCAGGGG - Intronic
1091124114 11:133081293-133081315 CCTCAGAGATGTCTGCTAGGTGG - Intronic
1091301285 11:134509757-134509779 GCTCACAGGAGACAGCTAGGAGG - Intergenic
1091373577 12:12474-12496 GCTCAGACCAGCCAGCTGGAGGG + Intergenic
1092526244 12:9311948-9311970 GCTCAGACCAGCCAGCTGGAGGG + Intergenic
1092541032 12:9419842-9419864 GCTCAGACCAGCCAGCTGGAGGG - Intergenic
1094512013 12:31102644-31102666 GCTCAGACCAGCCAGCTGGAGGG + Intronic
1095691271 12:45091969-45091991 CCACAGAGCAGCCAGCTACAGGG + Intergenic
1101835091 12:108289426-108289448 CCACAGAGCAGCCAGAAAGAGGG + Exonic
1103853274 12:123947034-123947056 ACTCAGAGCAGCCAGCGGGCCGG + Intronic
1106765688 13:32911511-32911533 CCACAGACCAGACAGTTAGGAGG - Intergenic
1108355870 13:49628388-49628410 CCTCAGAGCAGTCATCTTGCTGG - Exonic
1109388530 13:61665158-61665180 CCTCCCAGCAGCCAGCTCTGTGG + Intergenic
1112502284 13:99952396-99952418 CCTCAGAGCACCCAGCTCCCAGG + Intergenic
1112870391 13:103963722-103963744 ACTCTGAGGATCCAGCTAGGTGG + Intergenic
1113966747 13:114156966-114156988 CCTCAGAGAAAACAGCTAAGTGG - Intergenic
1114516475 14:23302823-23302845 GCTCAGAGCAGACCGCTAGCAGG - Exonic
1116102162 14:40453252-40453274 ACACAAAGAAGCCAGCTAGGAGG - Intergenic
1116616887 14:47150980-47151002 CCTCACTGCAGCCAGCTAGTTGG + Intronic
1117884933 14:60350542-60350564 CCCCAGAGCACCAGGCTAGGAGG - Intergenic
1118723428 14:68609825-68609847 ACTCTGAGGAGGCAGCTAGGGGG - Intronic
1119004913 14:70915906-70915928 CCTCAGAGCAGGAAGGAAGGAGG + Intronic
1119545642 14:75469631-75469653 ACTCAGATCAGCCACCCAGGAGG + Exonic
1119868122 14:77991047-77991069 CCCCAGAACAGCAAGCCAGGAGG - Intergenic
1121273125 14:92651162-92651184 CCCCAGAGCACCCAGCTGGTTGG + Intronic
1121614458 14:95303780-95303802 TCTCAGAACAGCCAGATGGGAGG - Intronic
1121629036 14:95409211-95409233 CCTCAGAGCAGCCAGCTAGGCGG - Intronic
1121780381 14:96618298-96618320 CCTCAGAACAGCCAGTGGGGTGG + Intergenic
1122235818 14:100330169-100330191 CCTCTGAGCAGCCTGCTGTGGGG - Exonic
1122284707 14:100643835-100643857 TCCCAGACCACCCAGCTAGGGGG - Intergenic
1122364349 14:101185623-101185645 CCACACAGCAGCCTGCAAGGTGG + Intergenic
1123029951 14:105446885-105446907 CCTCTGAGCAGAGAGCTAGGAGG - Intronic
1127685684 15:61341452-61341474 CTTAAGAAAAGCCAGCTAGGTGG + Intergenic
1128329624 15:66747138-66747160 CCTGAGAGGATCCAGCCAGGAGG + Intronic
1128577931 15:68789093-68789115 CCCCAGAGCAGCCAGCTTCTGGG + Intronic
1128637109 15:69309711-69309733 CCTCACAGTAGGTAGCTAGGTGG - Intronic
1129706664 15:77798356-77798378 GCTCAGGGCCGCCAGCCAGGTGG - Intronic
1130096761 15:80861956-80861978 CCTCAGAGCCGGCAGCTAAAAGG - Intronic
1131248978 15:90818735-90818757 GCTCAGAGAAGCCAGCTGGTGGG + Intergenic
1131310588 15:91287000-91287022 CCTCAGAGGGGCCAGCCATGGGG - Intronic
1132313320 15:100872759-100872781 CAACAGAGCAGCCAGCTCAGGGG + Intergenic
1132336248 15:101050393-101050415 TCCCAGAGCAGCCTGCCAGGGGG + Intronic
1134397467 16:13878240-13878262 CGTCAGGGCAGCCAGCTGAGAGG + Intergenic
1137676205 16:50305003-50305025 GCTCAGGGCAGCCTGCTTGGAGG - Intronic
1139336345 16:66234381-66234403 CCTAAGACCATCCAGCAAGGTGG - Intergenic
1141409058 16:83820300-83820322 CCACAGAGCAGCCAGCAGGGTGG - Intergenic
1141634738 16:85308228-85308250 CCTCTGAGATTCCAGCTAGGTGG - Intergenic
1141827571 16:86491880-86491902 CGTCACAGCAGCCAGCTCGCCGG + Intergenic
1142199314 16:88753522-88753544 CCTCGGAGTAGCCGGCTAGCAGG + Intronic
1142244979 16:88966268-88966290 CTCCAGAGCAGCCAGCTAACAGG + Intronic
1142257304 16:89020246-89020268 CCCCAGAGCAGCCAGCCCCGCGG + Intergenic
1142319212 16:89370277-89370299 CCTCAGAGCTGCCACATAGTTGG - Intronic
1142509497 17:385305-385327 CCTCTGAGCAGCCGGGCAGGAGG + Intronic
1143919213 17:10317597-10317619 GCTCAGAGCACCCTGCAAGGAGG + Intronic
1145835195 17:27949490-27949512 CCTCAGAGAAGCCAGCAGGTGGG - Intergenic
1148111862 17:45148955-45148977 CCACAGTGCGGCCAGCTAGCGGG - Exonic
1149223330 17:54440135-54440157 CCTCAAAGAAGACAGGTAGGAGG - Intergenic
1149684966 17:58530058-58530080 CTTCAGAGCTGCCATTTAGGTGG + Intronic
1150787663 17:68176001-68176023 CCACAGAGCAGCCATCCTGGTGG + Intergenic
1150987217 17:70212492-70212514 CCTCAGAGCAACCTGGTGGGAGG + Intergenic
1151430694 17:74060558-74060580 CTTGAGACCAGCCTGCTAGGAGG - Intergenic
1151575249 17:74949860-74949882 GCTCAGAGCTCCGAGCTAGGAGG + Exonic
1151670762 17:75570544-75570566 GCTCAGAGCAGCCAGCAGGGGGG + Intronic
1152758158 17:82095712-82095734 CCGCAGAGCAGAGAGCTCGGCGG + Intronic
1153270275 18:3313885-3313907 GCTCAAAGCAGTCAGGTAGGAGG + Intergenic
1157317906 18:46608721-46608743 CCTAAGAGCAGCAAGCCTGGAGG - Intronic
1157935194 18:51864643-51864665 ACTCGGAGCAGCCAGCTGGCTGG - Intergenic
1158381103 18:56931187-56931209 CCGCATAACAGCCAGATAGGTGG + Intronic
1158524208 18:58197811-58197833 CCACAGAGCAGCCTGTTGGGTGG + Intronic
1161358380 19:3832263-3832285 CATCTGAGCAGCCAGCTCTGAGG + Intronic
1161609871 19:5236548-5236570 CATCAGAGCAGCTTGCTTGGTGG + Intronic
1163101681 19:15101164-15101186 CCTCAGAGGAACCAGCAAAGGGG - Intergenic
1163602476 19:18257405-18257427 ACTCAGGGCAGCCAGCTGGTAGG + Exonic
1163649506 19:18509167-18509189 CCCCACAGCAGCCAGGTTGGAGG + Intronic
1164607961 19:29613541-29613563 CATCAGAGCAGCCAGCCCGTGGG + Intronic
1165123506 19:33578600-33578622 CCTCACACCAGCCAGCTTGAGGG - Intergenic
1165428272 19:35757355-35757377 CCTCAGAGCTGCCAGGGGGGAGG - Intronic
1165838840 19:38774811-38774833 CCTCTCAGCAGCCTGCTGGGTGG - Intergenic
1165840615 19:38787329-38787351 CCTCTCAGCAGCCTGCTGGGTGG + Intergenic
1166624621 19:44339411-44339433 TCTAAGAGCAGCCACCCAGGTGG + Intronic
1166751642 19:45166705-45166727 CCTGAGAGCAGCCAGCGGGAGGG - Intronic
1167341971 19:48921722-48921744 CTTCACAGCAGCCTGCTAAGTGG - Intronic
1167574315 19:50310430-50310452 CCTCAGAGCAACCAGAAGGGAGG - Exonic
1168153446 19:54460922-54460944 CTTCTGAGCACCCAGCGAGGAGG + Exonic
1168276400 19:55280837-55280859 CGCCAGAGGAGCCAGCTTGGTGG + Intergenic
925217644 2:2110975-2110997 CCCCAGCACAGCCAGCTATGGGG + Intronic
926116700 2:10218009-10218031 ACTCAGAGCACCAAGCTAGTAGG + Intergenic
926150927 2:10425228-10425250 ACTCAGGGCAGCCAGCTGTGTGG - Intronic
926773147 2:16396295-16396317 CCTCTGATAAGCCAGCTTGGAGG - Intergenic
927668070 2:25045895-25045917 AATTAGGGCAGCCAGCTAGGAGG + Intronic
929978386 2:46656459-46656481 CCATAGTGCAGCCAGCTATGGGG - Intergenic
932804111 2:74768540-74768562 CCTCAGGGCTGCCAGCTACTAGG - Intergenic
934601730 2:95663304-95663326 CCTCAGAGAAGCAAACTAGAGGG - Intergenic
936535089 2:113305470-113305492 CCTCAGAGAAGCAAACTAGAGGG - Intergenic
936674831 2:114702811-114702833 CCTCAGACCAACCAGCTGAGTGG + Intronic
936694308 2:114928541-114928563 CATGACAGCAGCCAGCCAGGGGG - Intronic
939976023 2:148718646-148718668 GCTCAGAGCAGCCAGAGAGAAGG - Intronic
941008476 2:160270865-160270887 TCTCAGAGCTTTCAGCTAGGTGG + Intronic
943427318 2:187752558-187752580 CCTGAAAGCAGCCAGGAAGGAGG - Intergenic
946227733 2:218273112-218273134 CCTCAGAGCTGCCGGCCAGGAGG + Intronic
947427427 2:229996392-229996414 CCTCCAAGCAGGCAGCTATGTGG - Intronic
947713187 2:232327246-232327268 CCTCAGTGCTGCCCGCTATGGGG + Intronic
948671572 2:239571820-239571842 CCTCAGAGCAGCCACCTGGAGGG + Intergenic
948863534 2:240764191-240764213 GCTGAGAGCAGCCAGCAAGGAGG - Intronic
948878973 2:240846177-240846199 CATGAGAGCAGCCAGGTGGGGGG + Intergenic
1172759192 20:37310069-37310091 CCACAGAGCAGCCAGTGGGGAGG + Intronic
1172765055 20:37346547-37346569 CCCCAGAGAAGCCAGCGAGCTGG + Intronic
1173454683 20:43192505-43192527 CCCCTGAGAAGCCAGCTAGCTGG - Intergenic
1175044268 20:56089688-56089710 CTTCAGAGGAGCCAGCGAGTAGG - Intergenic
1178736846 21:35160279-35160301 ACTCAGAGCAGCAAGGTGGGTGG + Intronic
1179175313 21:39003929-39003951 CCTTCAAGCAGCCAGTTAGGTGG + Intergenic
1180972419 22:19822449-19822471 CCACAGAGCAGCCAGCTGTGGGG - Intronic
1181282628 22:21730753-21730775 TCTCAGGGCAGCCATATAGGTGG - Intronic
1181328161 22:22067409-22067431 CCAGAGAGGAGCCAGCTAGTGGG - Intergenic
1181935599 22:26436256-26436278 CCTCAAAACAGCCAGCAAGTGGG - Intronic
1182414657 22:30213515-30213537 CCTCAGAGCTGCCATCTCAGTGG + Intergenic
1182444567 22:30382606-30382628 CCTCAGAGCAGCCAGCTGGGTGG + Intronic
1182520816 22:30883655-30883677 CCTGAGGGCACCCAGCAAGGAGG - Intronic
1182757589 22:32692312-32692334 ACTCAGAGCAGCCTGGGAGGTGG + Intronic
1184118607 22:42436356-42436378 CCTCAGTGAAGCCAGCTCAGAGG - Intergenic
1184562431 22:45270924-45270946 GCTCAGAGCAGTCAGGTAGTAGG - Intergenic
1184688673 22:46107741-46107763 CCCCAGGGCTGCCAGGTAGGTGG + Intronic
1184841276 22:47053589-47053611 CCTCAGAGACGCCAGCGAGGAGG + Intronic
950333521 3:12175943-12175965 CCTCACAGCAGCCCGCAAGCTGG - Intronic
952827958 3:37539759-37539781 CATCAGAGCAGCCAAATAGAGGG + Intronic
953070273 3:39513585-39513607 CCTCAGGGCAGCCTGCCTGGAGG + Exonic
953623186 3:44550007-44550029 CCTCAGAGAAGACAGGCAGGGGG + Intergenic
956329353 3:68088365-68088387 GCTCAGAGCAACCAGGAAGGTGG + Intronic
957027394 3:75198381-75198403 CCTCAGAGCACCCAGATATTTGG + Intergenic
959291682 3:104483159-104483181 CAACACAGCAGGCAGCTAGGTGG - Intergenic
961126727 3:124425419-124425441 CCTCAGACCATTCAGCTAGAAGG - Intronic
961500020 3:127325793-127325815 CTTCAGACCAGCCAGCCAGCTGG - Intergenic
961501570 3:127340120-127340142 CTCCAGTGCAGCCAGCCAGGGGG - Intergenic
962267580 3:133954774-133954796 CCTCAGATCACACAGCTGGGAGG + Intronic
962755438 3:138462225-138462247 CCACAGACCAGCCTGCTGGGAGG + Intronic
964474254 3:157084391-157084413 CCTGAGTGCAGACAGCAAGGAGG + Intergenic
965808188 3:172564629-172564651 GCTCAGTGCAGCGTGCTAGGAGG - Intergenic
965829556 3:172769055-172769077 CTTCAAAGCAGTCAGCAAGGTGG + Exonic
966939457 3:184736271-184736293 CCTGAGAAGGGCCAGCTAGGGGG + Intergenic
967945998 3:194804783-194804805 CAGCAGAGCAGCATGCTAGGAGG - Intergenic
968728936 4:2260879-2260901 CCTCACAGCAGCCAGGAGGGTGG + Intronic
968881375 4:3301812-3301834 CCTCCGAGGTGCCAGCAAGGAGG + Intronic
969251586 4:5971920-5971942 CCCCACAGCAGCCAGCCAGCCGG + Intronic
969458152 4:7312805-7312827 CTGCAGAGCAGCCAGCTCAGAGG - Intronic
969605101 4:8198464-8198486 CATCAGAGCAGGCAGACAGGCGG + Intronic
969682831 4:8652698-8652720 CCTCATGACAGCCAGCTCGGCGG - Intergenic
970004545 4:11397944-11397966 CCCCTGAGCAGCCAGCTTGTTGG - Exonic
971138558 4:23898365-23898387 CCTAAGACCAACCAGCTTGGAGG + Intronic
973707165 4:53592390-53592412 CACCAGAGCAGGCAGCTGGGAGG + Intronic
976213301 4:82692876-82692898 CCTCAGGGAAGCCAGCTTGTGGG - Intronic
976833043 4:89337031-89337053 GCTCAGAGAAGCCACCTTGGGGG - Intergenic
977163173 4:93662040-93662062 CCTCAGGGAAGCCAGGTAGCTGG - Intronic
977887438 4:102269205-102269227 CTTCAGAGCAACCATCTAAGAGG + Intronic
979599731 4:122574603-122574625 CCCCCGAGCAGCCAACTGGGAGG - Intergenic
984400063 4:179251946-179251968 CTGCAGCGCAGCCAGCTAAGGGG + Intergenic
985016379 4:185639244-185639266 GCTCAGAGCAGGCAGCCGGGAGG - Intronic
986764795 5:10915663-10915685 GCTCAAAGCAAGCAGCTAGGAGG + Intergenic
988433324 5:31145187-31145209 CTGGAGAGCAGCCTGCTAGGTGG + Intergenic
990712231 5:58596106-58596128 GCTAAAACCAGCCAGCTAGGTGG - Intronic
991419407 5:66426111-66426133 CCTCAGAGAAGACAGGAAGGGGG + Intergenic
997679622 5:135740680-135740702 CCTCAAAAAAGCCATCTAGGGGG + Intergenic
998801340 5:145872717-145872739 CCTCTGAGCAGTCAGCTTAGGGG + Exonic
999322603 5:150624724-150624746 TCCCGGAGCAGCCCGCTAGGCGG + Intronic
999816726 5:155184489-155184511 CCTCAGAGTAGAAAGCTATGCGG + Intergenic
1003986718 6:11442942-11442964 CCTGAGAGCAGCCAGGAGGGAGG + Intergenic
1004018542 6:11754895-11754917 CCCGAGAGCAGCCTGCTGGGCGG - Intronic
1004723590 6:18290315-18290337 CATCAGAGGAGCCAGCCAGCAGG - Intergenic
1005044469 6:21628860-21628882 TCTCAGAGCAACCAGAGAGGAGG - Intergenic
1006174066 6:32111233-32111255 CCTCAGAGAAGACAGCAAGAAGG + Intronic
1006908895 6:37551110-37551132 GCACACAGCAGCAAGCTAGGAGG + Intergenic
1007231176 6:40348621-40348643 CCTCAGAGCAGCTAGGAAGGGGG + Intergenic
1007263615 6:40581252-40581274 CCTCAGAGCAGACATCTCTGCGG - Intronic
1009029471 6:58038958-58038980 CCACAGAGCAGCCACCCGGGTGG + Intergenic
1009205007 6:60790348-60790370 CCACAGAGCAGCCACCCGGGTGG + Intergenic
1011630145 6:89315255-89315277 CCTCAGAGCAGCCCGTCAGGAGG - Exonic
1011970790 6:93220235-93220257 ACTCACAGTAGCCAGGTAGGTGG + Intergenic
1015512059 6:134047853-134047875 CCTGAGAGCAGCCGGCCAAGAGG - Intronic
1017114913 6:150967376-150967398 CATCAGAGAAGCCAGCAAAGCGG - Intronic
1017520121 6:155194539-155194561 CCTCAGAGCACATAGGTAGGAGG + Intronic
1017943789 6:159077248-159077270 CCTCAGTGCTGCGAGCGAGGCGG + Intergenic
1019116806 6:169771662-169771684 CGCCTGAGCAGCCACCTAGGAGG - Intronic
1019258186 7:64861-64883 CTTCAGAACAGCCTGCAAGGGGG - Intergenic
1020047870 7:5056782-5056804 CCCCAGAGCAGTGAGTTAGGAGG + Intronic
1025095092 7:56090518-56090540 CCTCAGAGCACCCAGCATGGTGG - Intronic
1026414399 7:70163129-70163151 CCTCATGGCTGCCAGCTATGAGG + Intronic
1028888339 7:95959334-95959356 GTTCAGACCAGCAAGCTAGGAGG + Intronic
1028963359 7:96774657-96774679 CCTCAGACCAGGCAGCTACCAGG + Intergenic
1029488728 7:100858827-100858849 CCTCAGCATAGCCAGCTAGGAGG - Exonic
1032834865 7:135662999-135663021 CCTCAGAAAAGCCAACTAGCAGG - Intronic
1034474312 7:151273925-151273947 CTTCAGAGCAGCCTGGCAGGAGG + Intronic
1034529127 7:151684430-151684452 CCTCAGAGGAGTCAGCTCAGAGG + Intronic
1036502364 8:9325537-9325559 CCCCAGAGCTGCCAGCCATGAGG + Intergenic
1036824620 8:11966471-11966493 CCTCACACCTGCCTGCTAGGAGG - Intergenic
1043423270 8:80122384-80122406 TCTCTGAGGAGCCAGCTATGGGG - Intronic
1044233557 8:89805902-89805924 CCCCAGAGGAGCCAGAGAGGAGG - Intergenic
1045366434 8:101480334-101480356 CCAAAGAGCAGCCAGCTAGCAGG - Intergenic
1045743353 8:105387563-105387585 ACTCAGAGCGGCCAGCCAGCCGG - Intronic
1046530906 8:115443691-115443713 CCTCACCCCAGCCTGCTAGGTGG - Intronic
1048270036 8:133021096-133021118 CCTGAGATCACACAGCTAGGAGG - Intronic
1048747795 8:137634571-137634593 CCTCTTAGCAGAAAGCTAGGAGG + Intergenic
1048922326 8:139242410-139242432 TCTCAGAGCAGCCACATAGTGGG + Intergenic
1051579457 9:18655027-18655049 CCTCAGATGGGCCAGCAAGGGGG - Intronic
1051690884 9:19710812-19710834 CTGCAAATCAGCCAGCTAGGAGG + Intronic
1051742188 9:20262811-20262833 CTTCAGTGCAGACACCTAGGAGG - Intergenic
1053420559 9:37974918-37974940 ACTCAGAGCTGCCAGCGGGGAGG + Intronic
1053500480 9:38585201-38585223 TCTGAGGGCTGCCAGCTAGGAGG + Intergenic
1055594133 9:77848451-77848473 CCTCAGAGATGCCAGCAATGGGG - Intronic
1056453855 9:86741732-86741754 TCTCTGAGCAGCCAGCTTGCCGG - Intergenic
1056803193 9:89708342-89708364 CCTCTGAGCAGCCAGTTCAGGGG + Intergenic
1057216303 9:93230686-93230708 CCCCTGAGCAGCCAGCTGGGTGG - Intronic
1057679874 9:97169626-97169648 TCTGAGGGCTGCCAGCTAGGAGG + Intergenic
1060009504 9:120031126-120031148 CCTCAAAGCAGACAGGGAGGAGG - Intergenic
1061014649 9:127974743-127974765 CCATGGAGCTGCCAGCTAGGTGG - Intronic
1061547081 9:131310714-131310736 CCAGAGACCACCCAGCTAGGAGG - Intergenic
1061587687 9:131579271-131579293 CCTCAGGGCAGCCAGCAGGCAGG - Exonic
1061846132 9:133389439-133389461 ACTCAGAGCAGCCAGCAGGATGG - Intronic
1062348746 9:136128492-136128514 CCTCAGCCCTGCCAGCTAGCGGG - Intergenic
1062390868 9:136333371-136333393 CCCCAGAGCAGGCAGCAGGGAGG + Intronic
1062589254 9:137266097-137266119 CACCAGAGCAGCCAGCAGGGCGG - Intronic
1189220540 X:39368009-39368031 CCTCAGTGTGTCCAGCTAGGAGG - Intergenic
1190063266 X:47224114-47224136 GCTCAGAGCCGGCAGCTAGGTGG - Intronic
1190118902 X:47644642-47644664 TCTGAGAGCAGCAAGCCAGGTGG + Intronic
1197446203 X:126553840-126553862 CTTCAGAGCAGCCAGTCAGGTGG + Intergenic
1199714617 X:150497715-150497737 TCTCACAGCAGCCAGCTCTGCGG + Intronic
1199970676 X:152858462-152858484 GTTCAGAGCAGGCACCTAGGAGG - Intronic
1200116365 X:153771409-153771431 CCTGAGGGCAGCCAGGCAGGCGG + Intronic
1202272677 Y:23086037-23086059 ACTCGGAGCAGCCAGCCAGACGG - Intergenic
1202293349 Y:23334645-23334667 ACTCGGAGCAGCCAGCCAGACGG + Intergenic
1202425674 Y:24719781-24719803 ACTCGGAGCAGCCAGCCAGACGG - Intergenic
1202445115 Y:24950304-24950326 ACTCGGAGCAGCCAGCCAGACGG + Intergenic