ID: 1121637689

View in Genome Browser
Species Human (GRCh38)
Location 14:95464921-95464943
Sequence AAATATAAGCTATATCTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 242
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 226}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121637686_1121637689 30 Left 1121637686 14:95464868-95464890 CCACTAGAAAAATCTGATGGGGA 0: 1
1: 0
2: 0
3: 15
4: 123
Right 1121637689 14:95464921-95464943 AAATATAAGCTATATCTGGGAGG 0: 1
1: 0
2: 2
3: 13
4: 226

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121637689 Original CRISPR AAATATAAGCTATATCTGGG AGG Intronic
901110825 1:6793010-6793032 ATATATAAGATATATATGAGTGG - Intronic
902915907 1:19639246-19639268 AAATGAAAGCTATTTCAGGGAGG - Intronic
903585022 1:24407989-24408011 AAATATGACCCATATCTGAGAGG - Intronic
907426376 1:54381874-54381896 AAATATAAGATATATCCTGTTGG - Intronic
907863861 1:58379906-58379928 AAATATCATCTCTAGCTGGGTGG - Intronic
909224720 1:73004836-73004858 AAATATAAGCACTATATGGATGG + Intergenic
910023179 1:82617931-82617953 AAAAATATGCTGTATCAGGGAGG + Intergenic
910581314 1:88828399-88828421 AAATCAAAGCTATCTTTGGGAGG - Intronic
911076969 1:93885063-93885085 GAATATACGATATATTTGGGGGG - Intergenic
912149234 1:106836724-106836746 ATATATAACCTATATATGGTGGG + Intergenic
912218920 1:107649854-107649876 AAATATGAGCTTTATGAGGGAGG - Intronic
912347055 1:108973405-108973427 AAATATAAGCTCCATCAGGGAGG + Intronic
915844354 1:159248158-159248180 AAATATAAGCTTTTCATGGGAGG - Intergenic
917299786 1:173561115-173561137 AAAGATAAGCTTCATATGGGAGG - Intronic
918031324 1:180815069-180815091 CAATATAAGGTATATATGGTGGG + Intronic
920843143 1:209571639-209571661 AAATATAAGAAATATTTAGGAGG + Intergenic
921876314 1:220200405-220200427 AAACGTAAGCTTTATCAGGGTGG + Intronic
922149167 1:222982471-222982493 AAACTTATCCTATATCTGGGAGG + Intronic
923640680 1:235756696-235756718 AAATATAAGCTCCATGAGGGTGG - Intronic
924642159 1:245844398-245844420 AATCATAACATATATCTGGGGGG - Intronic
1065053583 10:21820272-21820294 AAAAATATTCTATGTCTGGGGGG + Intronic
1069413504 10:68176706-68176728 AAATTTCATCTATTTCTGGGAGG + Intronic
1070245013 10:74722620-74722642 AAGTATAGCCTATATGTGGGGGG + Intergenic
1070978675 10:80627115-80627137 AAATGGAAGCCATTTCTGGGAGG + Intronic
1071171099 10:82865179-82865201 AAATCTAAGCTATAGCTCAGAGG + Intronic
1073372084 10:102999376-102999398 AAATATAAGCAATTTTTGGCCGG - Intronic
1073726588 10:106238791-106238813 AAATATAAGCTATTTCCCAGTGG - Intergenic
1074616210 10:115070885-115070907 AAATATATGCTGTATTTGGGGGG + Intergenic
1075661398 10:124199507-124199529 AAAGATAAACCATACCTGGGTGG + Intergenic
1078439791 11:11354968-11354990 AAATTCAAGCTATATTTAGGAGG - Intronic
1078928985 11:15898970-15898992 AAATATAAGCTTCATGAGGGAGG - Intergenic
1079626350 11:22621299-22621321 AAATTTACTCTCTATCTGGGTGG + Intergenic
1079663788 11:23077206-23077228 AAAAATAGGCTAAGTCTGGGTGG - Intergenic
1080930195 11:36802097-36802119 AAAAATAAGATATATCTGCCGGG - Intergenic
1081624094 11:44636548-44636570 AAATATAAACTCTCTCTGGAGGG + Intergenic
1081910478 11:46696888-46696910 AAATAAAAGCTATGGCTGAGGGG + Intronic
1083691387 11:64411056-64411078 AAATATAAGCTCCATGAGGGTGG - Intergenic
1085879531 11:80449520-80449542 AAAGATAAGCTTTGTCTAGGAGG - Intergenic
1086787309 11:90985075-90985097 AAATATAAGCTAAATTAGTGAGG + Intergenic
1087510968 11:99092817-99092839 TAATTGTAGCTATATCTGGGTGG + Intronic
1090297120 11:125598553-125598575 AAATATAAACTGAATTTGGGAGG - Intronic
1092296247 12:7201345-7201367 ACATATCAGCTATATTTGGGAGG + Intronic
1095209547 12:39476507-39476529 AAAAAAAAGCTATATTTGGCTGG - Intergenic
1096390689 12:51226634-51226656 TAATATAAGCAATAACTGGCTGG - Intergenic
1096401933 12:51314501-51314523 AGAAATAAGGTATATCTGGCTGG + Intronic
1101130930 12:101690386-101690408 CATTATCAGCAATATCTGGGAGG - Intergenic
1101280006 12:103243841-103243863 AAATATGTGTTATATCTGGAAGG + Intronic
1102090360 12:110182246-110182268 CTATAGAAGCTATAGCTGGGTGG - Intronic
1102628434 12:114255257-114255279 AAATATAGTTTTTATCTGGGTGG + Intergenic
1102658671 12:114505559-114505581 AAATAGCAGGTATATCTGAGAGG - Intergenic
1103594868 12:122018526-122018548 AAATATAAATTATTTCTAGGGGG + Intergenic
1104863679 12:131939895-131939917 AAATATAAGCGGCTTCTGGGAGG - Intronic
1106673367 13:31931254-31931276 AAATTTAGGATATATTTGGGAGG + Intergenic
1107314212 13:39113645-39113667 AAATATAAGCTCCATGAGGGTGG + Intergenic
1108260980 13:48656095-48656117 AAATTTTAGCTATGTCTGGTTGG + Intronic
1109054761 13:57533379-57533401 AAATATGGGCTATTTCTGAGAGG + Intergenic
1109647749 13:65282002-65282024 ATATATAATATATATCTTGGGGG - Intergenic
1112276291 13:98024034-98024056 AAATGCAAGCTATTTCTGGAGGG + Exonic
1113202625 13:107883843-107883865 AAATATAAAATATATCTCTGTGG + Intergenic
1114033211 14:18594467-18594489 AAATATCTGCAATATCTGGGGGG + Intergenic
1114078005 14:19173664-19173686 AAATATCTGCAATATCTGGGGGG + Intergenic
1114125730 14:19723298-19723320 AAATATCTGCAATATCTGGGGGG - Intronic
1114438054 14:22724536-22724558 AACTATAAGCTATTTATAGGAGG + Intergenic
1114855150 14:26429923-26429945 AAATATTAGCTCTATCAGGTAGG + Intergenic
1116300174 14:43170009-43170031 AAAAACAAGCTATTTGTGGGTGG + Intergenic
1117975828 14:61295836-61295858 AAATATAAGTTATTTATCGGGGG - Intronic
1118041167 14:61918708-61918730 AAAAAAAAGTTATCTCTGGGGGG + Intergenic
1120076550 14:80165806-80165828 AAATAAAAGCTAAATCTGAAGGG - Intergenic
1121163822 14:91772328-91772350 AAATACAAGCTCTATGAGGGCGG + Intronic
1121637689 14:95464921-95464943 AAATATAAGCTATATCTGGGAGG + Intronic
1123568971 15:21582597-21582619 AAATATCTGCAATATCAGGGGGG - Intergenic
1123605080 15:22017918-22017940 AAATATCTGCAATATCAGGGGGG - Intergenic
1124970013 15:34478958-34478980 AAAAATAAGTTCAATCTGGGAGG + Intergenic
1125654655 15:41346275-41346297 AAATATAAAATATATCTGTTGGG - Intronic
1129886278 15:79040055-79040077 AAATATAAGCAAAATCAGGCTGG - Intronic
1130148094 15:81290694-81290716 AAATATAAGCTAAATTTAGCTGG - Intronic
1131169752 15:90169402-90169424 AAATTTAAAATATATCTGGCTGG + Intronic
1132048801 15:98589989-98590011 GAATATAAGATATATATGGCTGG + Intergenic
1202977325 15_KI270727v1_random:309687-309709 AAATATCTGCAATATCAGGGGGG - Intergenic
1135256878 16:20948246-20948268 AAATATAGGATCCATCTGGGTGG - Intronic
1138523639 16:57588760-57588782 GAAGACAAGCTAAATCTGGGAGG + Intronic
1140100479 16:71912135-71912157 AAAGGTAAGCAATATTTGGGGGG - Intronic
1140640050 16:76960990-76961012 AAACATAAGCCATATTTGGCTGG + Intergenic
1140809715 16:78565786-78565808 GAATATAAGCTTTATCCAGGGGG + Intronic
1141352055 16:83307056-83307078 ACATATAAGCTACAGTTGGGTGG + Intronic
1142433268 16:90041837-90041859 AAATTTAAGCAATATGTAGGTGG + Intronic
1142796301 17:2310194-2310216 AAAAATAAGATATATTTTGGAGG - Intronic
1145868257 17:28254459-28254481 AAAAAAAAGCTATGTGTGGGTGG + Intergenic
1147783110 17:42958096-42958118 GCATACAAGCTGTATCTGGGTGG - Intronic
1149962318 17:61124333-61124355 AAGTAAAAGCTATATCTTGGTGG - Intronic
1155795353 18:30029178-30029200 AAATATAAAATATATTTGGAGGG + Intergenic
1155905919 18:31451020-31451042 AAATAAAAGCTATATTTGGGAGG + Intronic
1157968595 18:52239004-52239026 TAATCAATGCTATATCTGGGGGG - Intergenic
1159389316 18:67768269-67768291 AGTTATAAGCTAAAACTGGGAGG - Intergenic
1162239644 19:9339672-9339694 TAATTTAAGTTATATCTGAGAGG + Intronic
1168031006 19:53679688-53679710 AAATATAAGGTATGTGTGGTAGG + Intergenic
1168031229 19:53681584-53681606 AAATATAAGGTATATGTGGTAGG + Intergenic
1168031682 19:53684756-53684778 AAATATAAGGTATGTGTGGTAGG + Intergenic
1168039717 19:53748382-53748404 AAATATAAGGTATGTCTAGTCGG + Intergenic
1168041413 19:53762090-53762112 AAATATAATATATATCTAGTAGG + Intergenic
1168202577 19:54827110-54827132 GGATATAAGCTATGTTTGGGAGG + Intronic
926263333 2:11288976-11288998 AAATATGAACTATAACTGAGTGG - Intronic
926389314 2:12371317-12371339 CCATATTAGCTGTATCTGGGTGG + Intergenic
926777630 2:16438218-16438240 AAATATCTGCTATATATGGTAGG + Intergenic
927457450 2:23267159-23267181 AAAAATAAGTTAAATCTGGCCGG - Intergenic
927563358 2:24089585-24089607 AAATAGAGGCTATCTGTGGGTGG - Intronic
929565949 2:42984911-42984933 AAATAAAAGTGATACCTGGGTGG + Intergenic
929757994 2:44784143-44784165 AAATGCAAGCTATGTGTGGGCGG - Intergenic
930813981 2:55573427-55573449 AAATGTGAGCAATATGTGGGTGG + Intronic
931072867 2:58673656-58673678 AAATACAAAATTTATCTGGGTGG - Intergenic
932287787 2:70551586-70551608 AAAGTAAAGCTATATGTGGGAGG + Intronic
934890879 2:98068029-98068051 GTATATAAGCTATTTCTGGAAGG - Intergenic
936773074 2:115938434-115938456 AGATAAAAGCTTTCTCTGGGAGG + Intergenic
938111150 2:128566058-128566080 AAATATAACTTTTATTTGGGAGG + Intergenic
938655588 2:133429527-133429549 AAGTTGAAGCTAAATCTGGGGGG - Intronic
938891318 2:135708288-135708310 AAACATAAGCAATATTTGCGGGG - Intronic
941875340 2:170426554-170426576 AAATATAATCTGTCTCTAGGTGG + Intronic
943031922 2:182695716-182695738 AAAGATAAGCCACAACTGGGAGG + Intergenic
944619122 2:201495027-201495049 AAAAATAAACTATTTATGGGTGG - Intronic
946669350 2:222085788-222085810 AAATTTAATATATATCTGTGAGG - Intergenic
947304939 2:228735283-228735305 GAATATTGGATATATCTGGGGGG + Intergenic
948313342 2:237007161-237007183 AAATAGAAGCTATAATTGGCCGG + Intergenic
1168791938 20:583781-583803 AAATAGAAGATATTTCTTGGTGG - Intergenic
1169619482 20:7489392-7489414 ATATATAATATATATCTGGCTGG - Intergenic
1169992717 20:11521501-11521523 AGATTTAAGCAATATCTGGTTGG - Intergenic
1172476721 20:35244176-35244198 AAACAAAAGCTATAGCTAGGAGG + Intronic
1172935934 20:38620235-38620257 AAACATCAGCTATATTTGTGAGG + Intronic
1173630951 20:44515055-44515077 AAAAATATGGTATATCTGGCTGG + Intronic
1174197675 20:48785208-48785230 AAATAGAAATTATATCTGGCTGG - Intronic
1178626904 21:34226152-34226174 ATAGATAAGGAATATCTGGGGGG + Intergenic
1179068305 21:38047520-38047542 AGATATAAGATACCTCTGGGAGG - Intronic
1179128579 21:38614170-38614192 ACATATAAGTTATATGTAGGAGG - Intronic
1180457325 22:15521522-15521544 AAATATCTGCAATATCTGGGGGG + Intergenic
1181597013 22:23922353-23922375 AAATATAGGATATATCTGAGAGG - Intergenic
949735985 3:7172225-7172247 AAATGAGAGCTAAATCTGGGAGG + Intronic
953230330 3:41058808-41058830 AAATAAAGGATTTATCTGGGAGG - Intergenic
954446224 3:50548180-50548202 AAGTATAATCTAGAACTGGGTGG + Intergenic
954830286 3:53415571-53415593 AAATATAAGGTATCTCTGCCTGG - Intergenic
955678086 3:61470537-61470559 ATATAAAAGTTATATCTAGGTGG + Intergenic
956062520 3:65362037-65362059 GAATATAAGCTCTATTTGAGTGG - Intronic
957156698 3:76552696-76552718 ATATATAATCTATATTTGAGTGG + Intronic
957253314 3:77803433-77803455 AAATTTAAGCTCTATGAGGGCGG + Intergenic
957805062 3:85136275-85136297 AAATAAAAGCTACATTTAGGAGG - Intronic
959035845 3:101362773-101362795 AAGTATAAGCCATTTCTGGTTGG - Intronic
959145578 3:102540534-102540556 AAATATAAGCTGGGTTTGGGTGG + Intergenic
960166459 3:114407895-114407917 AAATGTAACCTATATGAGGGGGG + Intronic
960303723 3:116035648-116035670 TAATTTAAGAAATATCTGGGTGG - Intronic
962718766 3:138152495-138152517 AAATATAAGCGTTGGCTGGGAGG - Intergenic
964307945 3:155361125-155361147 AAATAAAGACTATTTCTGGGAGG - Intergenic
965536161 3:169825582-169825604 AAATATAAAGTACATGTGGGAGG + Intronic
965903092 3:173668444-173668466 AAGTAGAAGCCATATCTGGAAGG + Intronic
969064376 4:4466755-4466777 ATAAATCAGCTCTATCTGGGCGG - Intronic
969360800 4:6662553-6662575 AAATGTAAGCTTCATCAGGGCGG - Intergenic
971861831 4:32117519-32117541 AACTATTAGCTATATCTGATAGG + Intergenic
971928074 4:33040632-33040654 AAATATAGGTTATAACTAGGTGG + Intergenic
971987223 4:33841744-33841766 AAATTTAACCTATTTATGGGGGG + Intergenic
973140353 4:46760087-46760109 CAATATAATCTATATGTGGAAGG + Intronic
973716930 4:53686064-53686086 AAGTAGAAGTTATATCTAGGAGG + Intronic
974064117 4:57061802-57061824 AAAAATAAAATTTATCTGGGAGG - Intronic
975397170 4:73889905-73889927 ATATATAATCTATATATGAGTGG + Intergenic
976257781 4:83117103-83117125 AAATAAAAAATATGTCTGGGCGG + Intronic
976312915 4:83630298-83630320 AAATGTAGGCTATCGCTGGGTGG - Intergenic
976905767 4:90234163-90234185 AAATTTAACATTTATCTGGGTGG + Intronic
976958939 4:90942815-90942837 AAATCTAAACTATATCTTAGAGG - Intronic
977220307 4:94330420-94330442 AAAAAAAAGCTATTTCTGAGTGG - Intronic
977854168 4:101867784-101867806 AAATAAAAGCTATAAATGGTAGG + Intronic
978719266 4:111887887-111887909 AAATCTAAGCTAAATGTGGAAGG + Intergenic
983180367 4:164641556-164641578 AAATATATGGTATCTTTGGGAGG + Intergenic
985072375 4:186180319-186180341 TAATATAATGTATATCTGGAGGG + Intergenic
986020304 5:3795449-3795471 AAAAATTAGCTATGTCTGTGAGG + Intergenic
987139879 5:14934235-14934257 AAATATAAGCAACAACTGAGGGG - Intergenic
987793895 5:22604221-22604243 AAATATCAGCTATTTCTGGGGGG + Intronic
990040650 5:51375353-51375375 AAATATAAGCCATATCTTTTAGG - Intergenic
990660319 5:58006988-58007010 AAAAAAAAGCTATATTTGGCAGG + Intergenic
991571574 5:68059913-68059935 AAATAAAAACTTTATTTGGGAGG - Intergenic
991727542 5:69550849-69550871 AAATATAAGCTCTTTTAGGGTGG - Intronic
991867415 5:71077025-71077047 AAATATAAGCTCTTTTAGGGTGG + Intergenic
992560465 5:77947480-77947502 AAATATAAGCAAAAATTGGGTGG + Intergenic
992603763 5:78434018-78434040 AAACAAAAGCTTTATGTGGGAGG - Intronic
993784993 5:92119458-92119480 AAATACAAGTGATATCTGTGTGG - Intergenic
996004082 5:118400161-118400183 AAATATAATCTATTTCTTTGAGG - Intergenic
996844391 5:127883441-127883463 AAATATGAGCTATTTCTGTAAGG - Intergenic
997054716 5:130428142-130428164 AAAAAGAAGCAATATCTGGCCGG + Intergenic
997240707 5:132304745-132304767 AAATATGACCTATACATGGGGGG + Intronic
997755187 5:136389520-136389542 AAATATTAGATATTTCTGTGTGG + Intronic
998739395 5:145181613-145181635 TAATAGTAGCTATTTCTGGGTGG + Intergenic
999562913 5:152824797-152824819 CAATATAACCAATATCTTGGTGG + Intergenic
1000652822 5:163837951-163837973 AAATATAATCTATAACTGTTGGG - Intergenic
1003253054 6:4449280-4449302 AAAGATAAACTATATATGTGTGG + Intergenic
1004917007 6:20341525-20341547 CAATATCAGGTACATCTGGGGGG - Intergenic
1005079427 6:21942017-21942039 AAATAAAAGTTAATTCTGGGTGG - Intergenic
1005359727 6:25020364-25020386 AAATATAACCTATCTCAGGAAGG - Intronic
1007510387 6:42370309-42370331 AAATGTAAACGATATCTGAGTGG + Intronic
1009034061 6:58095029-58095051 AAATATAAGAAATATCAGTGAGG - Intergenic
1009209672 6:60846733-60846755 AAATATAAGAAATATCAGTGAGG - Intergenic
1010377689 6:75191571-75191593 TTATATAAGCTTTATCTGGAAGG - Intronic
1010549923 6:77209099-77209121 AAATATAACACATTTCTGGGAGG - Intergenic
1012007165 6:93727478-93727500 AAATATAAGATCTATCTAGAGGG - Intergenic
1012369263 6:98482764-98482786 AAATCTCAGCTATATCAGTGGGG + Intergenic
1013227555 6:108131343-108131365 AAATACAAAATATAGCTGGGCGG + Intronic
1013488462 6:110620704-110620726 AAAGATATGCTCTTTCTGGGAGG - Intronic
1014461536 6:121702475-121702497 AAATATCTGTTATATCTGGTTGG - Intergenic
1015284565 6:131470686-131470708 CAATCTGAGCTATGTCTGGGTGG + Intergenic
1020935310 7:14457116-14457138 AAATATATGATGTATCTGTGTGG - Intronic
1021447022 7:20744599-20744621 AAATATAAGCTACATCCATGGGG + Intronic
1021872992 7:25021926-25021948 AAATTTAACGTATATCTGGGGGG - Intergenic
1023566803 7:41531466-41531488 AAATATAATTTGTATTTGGGTGG - Intergenic
1023662942 7:42489284-42489306 ATATATATGCTATATATGTGAGG + Intergenic
1024371602 7:48590464-48590486 AAATAAAATCAATATCTGGAAGG - Intronic
1024874266 7:54004113-54004135 AAATATAAGCTCCATCTCTGTGG + Intergenic
1026356899 7:69565747-69565769 AAATAAAAGATATATTTGGCTGG - Intergenic
1031318515 7:120289495-120289517 AAATATGAAGTATTTCTGGGAGG + Intronic
1031369048 7:120941687-120941709 ACTTATAAGCTATACCTGGATGG + Intergenic
1031432042 7:121683790-121683812 AAATATATGCTATATCACGTGGG + Intergenic
1033504972 7:141990865-141990887 AAATCAAAGCCATAGCTGGGTGG - Intronic
1037198065 8:16216131-16216153 AATGATAAGTTATATCTGGAAGG + Intronic
1041273669 8:56135020-56135042 AAATGTAATCTCTATGTGGGTGG + Intergenic
1041476715 8:58275528-58275550 AAATAAAAGCTATGTCTTGGTGG + Intergenic
1042328544 8:67554539-67554561 ATATTTAAACTATATCAGGGAGG + Intronic
1042387457 8:68194048-68194070 AAATATCATCTGTATCTGAGTGG + Intronic
1043397357 8:79852084-79852106 AAATAGAAAATTTATCTGGGTGG + Intergenic
1044230229 8:89766582-89766604 AAAGATAAACTATAACTGGGAGG - Intronic
1044230250 8:89766937-89766959 AAAGACAAACTATAACTGGGAGG - Intronic
1044825244 8:96189794-96189816 AAATAAAAAGTATATCTGTGGGG - Intergenic
1050200108 9:3135602-3135624 AAAAATAAGCTTTATTTGGCTGG - Intergenic
1051729322 9:20123200-20123222 AACTATAAGCTAGCTCTGTGGGG + Intergenic
1051788518 9:20773202-20773224 AAATATATGCTAAAGGTGGGGGG - Intronic
1052031834 9:23637758-23637780 AAATAGGTGCTACATCTGGGAGG - Intergenic
1055362101 9:75503008-75503030 AAATATTAAATTTATCTGGGAGG - Intergenic
1058499450 9:105595825-105595847 ATCTATAAGCTATAGATGGGAGG - Intronic
1058897869 9:109415685-109415707 AAATGTAAGAGATGTCTGGGAGG + Intronic
1059860914 9:118460387-118460409 AAATATAATCCATGTCGGGGTGG - Intergenic
1186529450 X:10280419-10280441 AAAAAAAAGCCATTTCTGGGTGG - Intergenic
1188523180 X:31060971-31060993 AAATGTAGGCTCTGTCTGGGAGG - Intergenic
1188557771 X:31431267-31431289 AAATATAAGCTATAATTCAGAGG + Intronic
1192367827 X:70489458-70489480 AAATATAAAAATTATCTGGGCGG - Intronic
1194215601 X:91127317-91127339 AAATATAAGTAATGTTTGGGGGG - Intergenic
1195037646 X:100984661-100984683 AAACGTAAGCTATATGAGGGAGG - Intronic
1197001770 X:121448438-121448460 GAAGATAAGCTATATGTGGCAGG + Intergenic
1198926724 X:141804982-141805004 AAATATAAGCTGTATGAGGCTGG - Intergenic
1201382264 Y:13394816-13394838 AAACATAAATTATACCTGGGAGG + Intronic
1201598766 Y:15703514-15703536 AAATATAAGTGAGCTCTGGGAGG - Intergenic