ID: 1121637892

View in Genome Browser
Species Human (GRCh38)
Location 14:95466123-95466145
Sequence GCCCAGCTGGAGCTCGATGT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 218
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 203}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121637886_1121637892 14 Left 1121637886 14:95466086-95466108 CCTGGGCGTGGCTCAGCTGCCAC 0: 1
1: 0
2: 2
3: 24
4: 226
Right 1121637892 14:95466123-95466145 GCCCAGCTGGAGCTCGATGTGGG 0: 1
1: 0
2: 0
3: 14
4: 203
1121637888_1121637892 -5 Left 1121637888 14:95466105-95466127 CCACTGCTTCTCCTTCAGGCCCA 0: 1
1: 0
2: 0
3: 53
4: 517
Right 1121637892 14:95466123-95466145 GCCCAGCTGGAGCTCGATGTGGG 0: 1
1: 0
2: 0
3: 14
4: 203

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121637892 Original CRISPR GCCCAGCTGGAGCTCGATGT GGG Exonic
903500065 1:23795822-23795844 GCCCAGCTGGGGTTTGAGGTAGG + Exonic
906516312 1:46440810-46440832 GCCCAGCTGGACCTGGGTGGGGG + Intergenic
910034792 1:82777099-82777121 GGCCAGCTGGAGTTCCAGGTGGG - Intergenic
914928035 1:151906179-151906201 GACCAGCTGGAGTTCCAGGTGGG + Intronic
915144718 1:153789669-153789691 GCCCTCCTGGAGCTCGCTCTGGG + Intergenic
916072367 1:161177622-161177644 GCCCACCTGGAACGCGTTGTAGG + Exonic
916286363 1:163109674-163109696 CCACAGCTTGAGCTCTATGTTGG + Intergenic
917445433 1:175102618-175102640 GGCCAGCTGGAGTTCTAGGTGGG - Intronic
917446388 1:175108775-175108797 GGCCAGCTGGAGTTCTAGGTGGG - Intronic
918058976 1:181045877-181045899 GGCCAGCTGGAGTTCCAAGTGGG + Intronic
922173605 1:223177873-223177895 GCCCAGCTGGAACTTGAGCTTGG + Intergenic
923573783 1:235140327-235140349 GGCCAGCTGGAGTTCCAGGTGGG + Intronic
923930104 1:238684948-238684970 GGCCAGCTGGAGTTCCAGGTGGG - Intergenic
924383631 1:243484012-243484034 GCCGAGCTGGAGCTCTAGCTGGG - Intronic
1065441309 10:25756041-25756063 GGCCAGCTGGAGTTCCAGGTGGG + Intergenic
1066544269 10:36482314-36482336 GGCCAGCTGGAGTTCCAGGTGGG - Intergenic
1068968607 10:62938883-62938905 CCCCAGCTGGAGTTTGTTGTTGG - Intergenic
1071387976 10:85141442-85141464 GGCCAGCTGGAGTTCCAGGTGGG + Intergenic
1071456821 10:85857445-85857467 GCCCAGCGGGAGCCCAATGGGGG + Intronic
1074999205 10:118782945-118782967 GGCCAGCTGGAGTTCCAGGTGGG + Intergenic
1075420189 10:122294887-122294909 GCCCAGCTAGTGCTCCCTGTAGG + Intronic
1075875831 10:125804863-125804885 GCCTAGCTGGGGCTGGAGGTGGG - Intronic
1076137413 10:128054687-128054709 GACCAGCTGGAGCTCATGGTGGG - Intronic
1076687115 10:132203160-132203182 GCCCAGTTGGACCTCAGTGTGGG + Intronic
1076761096 10:132606137-132606159 ACGCAGCTGCAGCTGGATGTGGG + Intronic
1078185699 11:9050522-9050544 GCCGAGCTGGAGGTCCATGGGGG - Intronic
1078442499 11:11379084-11379106 GCCCACGTGGAGTTCAATGTGGG - Exonic
1078572253 11:12469341-12469363 GCCCAGCTGAAGGTCGGGGTAGG - Intronic
1078795795 11:14591105-14591127 GGCCAGCTGGAGTTCCAGGTGGG + Intronic
1078916931 11:15786958-15786980 GCCCAGCTGGAGTGCAATGGCGG - Intergenic
1080107520 11:28526101-28526123 GGCCAGCTGGAGCTCCAGATGGG - Intergenic
1081329737 11:41788544-41788566 GGCCAGCTGGGGCTCCAGGTGGG - Intergenic
1081910685 11:46697935-46697957 ACCCAGCTGGAGGTCGCTATGGG - Intronic
1083255324 11:61491849-61491871 GCCCGGCTGGGGCTCCATGTGGG + Intergenic
1084323522 11:68386388-68386410 GTCCACCTGCAGCACGATGTCGG - Exonic
1084860507 11:72014899-72014921 GCTTATCTGGAGCTCGCTGTGGG + Exonic
1085121708 11:73971569-73971591 GCCCAGTTGGACCTGGATGCTGG - Intergenic
1087486415 11:98763727-98763749 GGCCAGCTGGAGTTCGGGGTGGG - Intergenic
1088385627 11:109251713-109251735 GCCCAACTGTACATCGATGTTGG - Intergenic
1091095436 11:132817064-132817086 GCTCAGGTGGAGTTAGATGTGGG + Intronic
1092142133 12:6191188-6191210 GGCCAGCTGGAGTTCCAGGTGGG - Intergenic
1092272900 12:7037468-7037490 GGCCAGCTGGAGTTCCAGGTGGG + Intronic
1093967236 12:25340562-25340584 CCCCAGCAGGAACTCTATGTGGG + Intergenic
1094666460 12:32525716-32525738 GGCCAGCTGGAGTTCCAGGTGGG + Intronic
1094718222 12:33034249-33034271 GGCCAGCTGGAGTTCCAGGTGGG - Intergenic
1099732805 12:86526482-86526504 GCCCTGCTGGAGCTCTCTGCTGG + Intronic
1099790687 12:87330258-87330280 GGCCAGCTGGAGTTCGGGGTGGG + Intergenic
1099846181 12:88031255-88031277 CCACAGCTCGAGCTCTATGTTGG + Intronic
1100166641 12:91924207-91924229 GGCCAGCTGGAGTTCCAGGTGGG - Intergenic
1102309730 12:111835697-111835719 GGCCAGCTGGAGTTCCAGGTGGG + Intergenic
1104827833 12:131726711-131726733 GACCAGCTGGTGCTCGATGCTGG + Intronic
1104996377 12:132660211-132660233 GCACAGCTCCAGCTGGATGTGGG - Intronic
1107259408 13:38472748-38472770 GGCCAGCTGGAGCTCCGGGTGGG - Intergenic
1107888075 13:44891145-44891167 GCCCAGCTGGAGCTGTCTTTCGG - Intergenic
1109441338 13:62379269-62379291 GGCCAGCTGGAGTTCCAGGTGGG + Intergenic
1111748298 13:92296708-92296730 GGCCAGCTGGAGTTCCGTGTGGG + Intronic
1112538247 13:100282489-100282511 GGCCAGCTGGAGTTCCAGGTGGG + Intronic
1113472606 13:110557672-110557694 ACGCAGCTGGAGCTGGATGCCGG + Intronic
1117077840 14:52122286-52122308 GGCCAGCTGGAGTTCCAGGTGGG + Intergenic
1119300348 14:73566651-73566673 GGCCAGCTGGAGTTCCAGGTGGG - Intergenic
1119472268 14:74907474-74907496 GGGCAGCTGGAGCTGGGTGTGGG + Exonic
1119545751 14:75470049-75470071 GCCCTGCTGGAGTTTGCTGTGGG + Exonic
1120330953 14:83092427-83092449 GGCCAGCTGGAGTTCCAGGTAGG + Intergenic
1121637892 14:95466123-95466145 GCCCAGCTGGAGCTCGATGTGGG + Exonic
1122239733 14:100355039-100355061 GCCCAGTTGGAGATCTATCTGGG + Intronic
1125480320 15:40075091-40075113 GGCCAGCTGGAGTTCCAGGTGGG - Intergenic
1127830687 15:62748427-62748449 GCCCTGCGGGAGCTCGAGGTAGG + Exonic
1128110818 15:65075067-65075089 GGCCAGCTGGAGTTCCAGGTGGG + Intronic
1128283291 15:66415118-66415140 GCCAAGCTGGAGCTTGATGCAGG - Intronic
1128551974 15:68603755-68603777 ACCCTGCTGGACCTTGATGTTGG + Intronic
1130207227 15:81888255-81888277 GCCCAGCTGAGGCTCCGTGTGGG + Intergenic
1131517756 15:93090120-93090142 CCCCAGCTGGAGCGTGAAGTCGG + Intergenic
1131798546 15:96046049-96046071 GCCCAGCTCGTGCTAGGTGTGGG + Intergenic
1132200791 15:99953358-99953380 GCCCTGCTGGATCTTGATCTGGG + Intergenic
1132394701 15:101464205-101464227 GCCCAGGTGGCGCAGGATGTGGG - Intronic
1132994609 16:2816765-2816787 GCCCAGCGGGAGCCCGCAGTGGG + Intergenic
1133525404 16:6600316-6600338 GCTCAGCTGGAGCTCAATGCTGG - Intronic
1136871563 16:33812331-33812353 GGTCAGCTGGAGCACGAGGTGGG - Intergenic
1137546774 16:49410293-49410315 GGCCAGCTGGTGCTGGCTGTTGG + Intergenic
1138693631 16:58791103-58791125 GGCCAGCTGGAGTTCCAGGTAGG - Intergenic
1139761418 16:69187335-69187357 GCCGAGCTGGAGCCCGCTCTGGG + Exonic
1141636617 16:85317377-85317399 GCACCGCTGGAGCTGGAGGTAGG - Intergenic
1141688890 16:85585543-85585565 GCCCAGCTGGGTCTCCATGTGGG + Intergenic
1142224763 16:88872023-88872045 GGCCACCTGGAGCTCCAGGTGGG - Intergenic
1203100609 16_KI270728v1_random:1303727-1303749 GGTCAGCTGGAGCACGAGGTGGG + Intergenic
1145985733 17:29044970-29044992 GCCCAGCTGGAGCACGAGGCTGG + Exonic
1146945277 17:36869394-36869416 TCCCTGCTGAAGCTGGATGTTGG - Intergenic
1147667208 17:42156307-42156329 GACCAGATGGAACTAGATGTGGG - Intergenic
1148327106 17:46789755-46789777 GCCCAGCTGGAGGTCCAAGCTGG - Intronic
1150356603 17:64491582-64491604 GCCAAGCTGGATCTTGATGTGGG + Intronic
1153434971 18:5059283-5059305 GCCCTGCTGGACCTTGATTTTGG + Intergenic
1153720564 18:7897221-7897243 GCCCAGCTGGAGCCAGAATTTGG + Intronic
1156538031 18:37882726-37882748 ACCCTGCTGGAGCTAGATGGGGG - Intergenic
1156651097 18:39228022-39228044 CCACAGCTGGAGCTCTCTGTTGG - Intergenic
1156863629 18:41865800-41865822 GGCCAGCTGGAGTTCCAGGTGGG + Intergenic
1157493452 18:48139371-48139393 ACCCAGCTGGAGCGGGATGTGGG + Intronic
1159656136 18:71031656-71031678 GGCCAGCTGGAGTTCCAGGTGGG - Intergenic
1161613793 19:5258306-5258328 GCCCTGGTGGGGCTAGATGTGGG - Intronic
1162262076 19:9541641-9541663 GGCCAGCTGGAGTTCCAGGTGGG - Intergenic
1162933759 19:13970249-13970271 TCCCAGCTGGAAGTCGATGTGGG - Intronic
1165461119 19:35944955-35944977 GTCCAGCTGGACCACGGTGTGGG - Exonic
1166072358 19:40394675-40394697 CCCCAGCTTGAGCTGGACGTGGG - Exonic
1166998220 19:46729942-46729964 TCCCAGCTGGGCCTCGATGGAGG + Intronic
926814276 2:16784862-16784884 GCACAGCTGGAGATTGATGGAGG - Intergenic
929379657 2:41335633-41335655 GGCCAGCTGGAGTTCCAGGTGGG + Intergenic
929613629 2:43290928-43290950 GCCCAGCTGGCTCTGGATGGAGG - Intronic
934157864 2:89219912-89219934 ACCCTGCTGGACCTTGATGTTGG - Intergenic
934209398 2:89962510-89962532 ACCCTGCTGGACCTTGATGTTGG + Intergenic
935734636 2:106097045-106097067 GCCCAGCAAGAGCTCGGTGGGGG + Intronic
937355022 2:121192808-121192830 GCCCAGCAGGGGCTCGTTCTGGG - Intergenic
937437204 2:121890310-121890332 AGCCAGCTGGAGCTCGGTGGTGG - Intergenic
937881241 2:126866435-126866457 GCCCAGTAGGAACTCTATGTCGG + Intergenic
938208578 2:129444634-129444656 GCCCAGGAGGAGCTCACTGTGGG + Intergenic
939281724 2:140073833-140073855 GGCCAGCTGGAGTTCCAGGTGGG + Intergenic
939972566 2:148678705-148678727 GGCCAGCTGGAGTTCCAGGTGGG - Intronic
941110841 2:161417426-161417448 GCCCAGGTGGAGAGCGAGGTTGG - Intronic
942867257 2:180691430-180691452 GGCCAGCTGGAGTTCCAGGTGGG + Intergenic
943835131 2:192508011-192508033 GGCCAGCTGGAGTTCCAGGTGGG + Intergenic
946358113 2:219201745-219201767 GGCCAGCTGGAGTTCCAGGTGGG - Intronic
947716506 2:232341894-232341916 GCCCAACTGGTGCTGGCTGTGGG - Intronic
948893133 2:240916558-240916580 GCCCAGCTGGAGCCGGAGGGGGG - Intergenic
1168827333 20:822784-822806 GCCCAGCTGGTGCTCACTTTGGG - Intergenic
1171118725 20:22549665-22549687 GCACAGCCTGAGCTCTATGTTGG + Intergenic
1175180687 20:57144736-57144758 ACCCAGCTGGACCTCGATCTTGG - Intergenic
1175231086 20:57473777-57473799 CCCCAGAGGGAGCTCGATTTGGG - Intergenic
1181617036 22:24061969-24061991 GTCCAGCTGGAGTTCCATGCAGG - Exonic
1181803147 22:25360129-25360151 GTCCAGCTGCAGCACGATGTCGG + Exonic
1183465363 22:37977710-37977732 GCCCAGAGGGAGCTCCATGGGGG - Intronic
950736552 3:15013680-15013702 GCCCAGATGGAGCTGGAACTGGG + Exonic
951170543 3:19536915-19536937 GTCCAGCTGCAGCTCCATGCAGG - Intergenic
952275217 3:31870164-31870186 GGCCAGCTGGAGTTCCAGGTGGG + Intronic
952593607 3:34988407-34988429 GACCAGCTGGAGTTCCAGGTGGG + Intergenic
952738191 3:36710804-36710826 GCCATGCTGTAGCTCCATGTGGG - Intergenic
953522521 3:43656743-43656765 GGCCAGCTGGAGTTCCAGGTGGG - Intronic
954660311 3:52223561-52223583 GCCCTGCGTGTGCTCGATGTGGG - Exonic
955183320 3:56691923-56691945 GGCCAGCTGGAGTTCCGTGTGGG + Intergenic
956445359 3:69320884-69320906 GGCCAGCTGGAGACCGAGGTGGG - Intronic
959422711 3:106148670-106148692 GGCCAGCTGGAGTTCCAGGTGGG + Intergenic
965077967 3:164003014-164003036 GGCCAGCTGGAGTTCCAGGTGGG + Intergenic
965236776 3:166135564-166135586 ACCCACCTGGAGCTGGAAGTGGG + Intergenic
967763012 3:193246452-193246474 GGACAGCTTGAGCTCGATGCGGG - Intronic
967879954 3:194294758-194294780 TCCCAGCAGGAGCTAGATGGAGG + Intergenic
968722041 4:2214750-2214772 GCCCATCTTGAGCTCCCTGTGGG - Intronic
970803496 4:20004055-20004077 GGCCAGCTGGAGTTCCAGGTGGG + Intergenic
974128986 4:57730095-57730117 GGCCAGCTGGAGTTCCAGGTGGG - Intergenic
976406357 4:84664761-84664783 GGCCAGCTGGAGTTCCAGGTGGG + Intergenic
978457005 4:108905830-108905852 GCCAAGCTGGAGCAGTATGTCGG + Intronic
979949534 4:126874755-126874777 GGCCAGCTTGAGCTCCAGGTGGG - Intergenic
981176613 4:141690175-141690197 GGCCAGCTGGAGTTCCGTGTGGG - Intronic
983230685 4:165126254-165126276 GGCCAGCTGGAGTTCGGGGTGGG - Intronic
984901723 4:184591952-184591974 GGCCAGCTGGAGTTCCAGGTGGG + Intergenic
986946761 5:13030189-13030211 GCCCACCTGCAGCTCAATGGGGG + Intergenic
988787310 5:34576955-34576977 GCCCCGCTGAAGCTCCATGGTGG - Intergenic
991399384 5:66237268-66237290 GCCCATCAGGAGCTCACTGTGGG - Intergenic
993320960 5:86466997-86467019 GGCCAGCTGGAGTTCCAGGTGGG - Intergenic
993943746 5:94094229-94094251 ACCCTGCTGGACCTTGATGTAGG - Intronic
995568649 5:113457188-113457210 GGCCAGCTGGAGTTCCAGGTGGG + Intronic
996535858 5:124577055-124577077 GCCCACCTTGAGCTCTAGGTTGG + Intergenic
999855311 5:155587067-155587089 GGCCAGCTGGAGTTCCAGGTGGG - Intergenic
1000066006 5:157693882-157693904 GGCCAGCTGGAGTTCCAGGTGGG + Intergenic
1002315791 5:178342221-178342243 GACCTGCTGGAGCTCCAGGTGGG - Intronic
1002401040 5:178991733-178991755 GCCTGGCTGGTGCTCCATGTGGG - Intronic
1002535847 5:179874940-179874962 GCCCAGCAGCTGCTCCATGTTGG + Exonic
1003736871 6:8887211-8887233 GGCCAGCTGGAGTTCGGGGTGGG + Intergenic
1003947253 6:11087261-11087283 GGCCAGCTGGAGCTCCGGGTGGG + Intergenic
1004053180 6:12108706-12108728 GGCCAGCTGGAGCTCCGGGTGGG - Intronic
1004224372 6:13772534-13772556 GGCCAGCTGGAGTTCCAGGTGGG + Intergenic
1004879419 6:19992432-19992454 GATCAGCTGGAGCTAGAGGTGGG + Intergenic
1004906961 6:20245086-20245108 GGCCAGCTGGAGTTCCAGGTGGG - Intergenic
1006227095 6:32548241-32548263 GGCCAGCTGGAGTTCCAGGTTGG - Intergenic
1006695984 6:35931311-35931333 GGCCAGCTGGAGTTCCAGGTGGG + Intergenic
1011662927 6:89609660-89609682 GCCAGGCTGGAGCGCGATCTCGG + Intronic
1012019853 6:93904955-93904977 ACCCAGTGGGAGCTCAATGTGGG + Intergenic
1013312345 6:108907791-108907813 GCCAAGCTGGATCTTGATGGGGG - Intronic
1014715743 6:124862567-124862589 CCACAGCTTGAGCTCTATGTTGG + Intergenic
1016069915 6:139726664-139726686 GGCCAGCTGGAGTTCCAGGTGGG - Intergenic
1016529308 6:145040226-145040248 GCCCTGCTGGACCTTGATTTTGG - Intergenic
1018624674 6:165765602-165765624 GGCCAGCTGGAGTTCCAGGTGGG - Intronic
1024944256 7:54792817-54792839 GCCCAGCTGCTGCTCCATCTAGG - Intergenic
1024974715 7:55102325-55102347 GCCCTGCTGGAGGTCGAAGGTGG - Intronic
1027868068 7:83673362-83673384 GGCCAGCTGGAGTTCCAGGTGGG + Intergenic
1029285091 7:99460125-99460147 GCCAAGCTGGATCTTGATGCGGG - Exonic
1033810096 7:145002088-145002110 CCCCAGCTGGACCTAGAGGTGGG - Intergenic
1035352537 7:158256657-158256679 GCCCAGCAGAAGCTCCATGTTGG + Intronic
1037263871 8:17037134-17037156 GGCCAGCTGGAGTTCCAGGTGGG - Intronic
1037940855 8:22949763-22949785 GCCCAGCTGTAGGCTGATGTAGG + Intronic
1038174042 8:25164540-25164562 GGCCAGCTGGAGTTCCAGGTGGG + Intergenic
1038639375 8:29311509-29311531 GGCCAGCTGGAGTTCCAGGTGGG + Intergenic
1039069144 8:33634149-33634171 GGCCAGCTGGAGTTCCGTGTGGG - Intergenic
1040954951 8:52970163-52970185 GGCCAGCTGGAGTTCCAGGTGGG - Intergenic
1041804384 8:61834206-61834228 GCCCAGCTTGATATTGATGTGGG - Intergenic
1043073378 8:75665781-75665803 GGCCAGCTGGAGTTCCAGGTGGG - Intergenic
1043110093 8:76169652-76169674 GGCCAGCTGGAGTTCCAGGTGGG + Intergenic
1043517898 8:81013351-81013373 GCCCAGGTGCAGCTGGATATGGG - Intronic
1044788653 8:95823682-95823704 GGCCAGCTGGAGTTCCAGGTGGG + Intergenic
1044874345 8:96649497-96649519 GACTAGCTGGAGCTGGATATGGG + Intronic
1047011620 8:120678961-120678983 GCCCAGCTGGGGTTGGAGGTAGG - Intronic
1048875884 8:138836974-138836996 TCCCAGCTGGAACTCTGTGTGGG - Intronic
1048876371 8:138839569-138839591 TCCCAGCTGGAACTCTGTGTGGG - Intronic
1049783215 8:144438495-144438517 GCGCAGCTGGCCCTCGATGCAGG + Exonic
1053027316 9:34740553-34740575 GGCCAGCTGGAGTTCCAGGTGGG - Intergenic
1053311561 9:37024045-37024067 GCACAGCTGGAGCTGGTTCTTGG - Intronic
1055014858 9:71605326-71605348 GCCCAGCTTTAGCTAGACGTAGG + Intergenic
1055516620 9:77040475-77040497 GCCAAGCTGGATCTTGATGCAGG + Intergenic
1057271449 9:93653873-93653895 GACCAGCTGGACCTGGATCTGGG + Intronic
1057543889 9:96002036-96002058 GGCCAGCTGGAGTTCCAGGTGGG - Intronic
1061483797 9:130910164-130910186 GGCCAGCTGGAGTTCCAGGTGGG + Intronic
1062453993 9:136627191-136627213 GCCCAGCTGGAGCACGGGGAGGG + Intergenic
1186508022 X:10109783-10109805 GGCCAGCTGCTGCTGGATGTTGG - Exonic
1189853595 X:45200809-45200831 CCCCAGCTGGGGCTCCATCTTGG + Exonic
1193883847 X:86960618-86960640 GCCCTGCTGGAGCTCTCTGTTGG + Intergenic
1195258061 X:103107667-103107689 GGCCAGCTGGAGTTCCAGGTGGG - Intergenic
1195896397 X:109749636-109749658 GGCCAGCTGGAGTTCCAGGTGGG - Intergenic
1196781495 X:119387902-119387924 GGCCAGCTGGAGTTCCAGGTGGG - Intergenic
1199175509 X:144783676-144783698 GGCCAGCTGGAGTTCCAGGTGGG + Intergenic
1199356280 X:146867199-146867221 GGCCAGCTGGAGTTCCAGGTGGG - Intergenic
1201541575 Y:15110650-15110672 GGGAAGCTGGAGCTTGATGTGGG - Intergenic
1202109810 Y:21407244-21407266 GGCCAGCTGGAGTTCCAGGTGGG + Intergenic