ID: 1121638493

View in Genome Browser
Species Human (GRCh38)
Location 14:95469813-95469835
Sequence CCATTTGCACACATTGGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 194
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 178}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121638493 Original CRISPR CCATTTGCACACATTGGGGA AGG (reversed) Intronic
901758449 1:11455522-11455544 CCATGTGCAGCCATCGGGGAGGG + Intergenic
902765992 1:18615653-18615675 CCATTGGCTCTCCTTGGGGATGG - Intergenic
903183942 1:21619130-21619152 CCCCTTGCACGCCTTGGGGAGGG - Intronic
903232005 1:21927625-21927647 CCAACTGCACACATCTGGGAAGG + Intronic
905684547 1:39899471-39899493 CCATTTGCACACGATGGGGTTGG - Intronic
906065507 1:42977720-42977742 ACACATGGACACATTGGGGAGGG - Intergenic
907159933 1:52362392-52362414 ACATTTGTCCACAATGGGGAGGG + Intronic
908900635 1:68952414-68952436 CCTTCTGGACACATTGGGGTGGG - Intergenic
910184952 1:84528963-84528985 CCATTTGAAATCAGTGGGGAGGG - Intergenic
911266408 1:95749927-95749949 CCTTTTGTACACACTGTGGATGG + Intergenic
911304309 1:96214382-96214404 GCGTGTGCACACATTGGGGTGGG - Intergenic
914400581 1:147316513-147316535 CCATTTGAGCTCCTTGGGGAAGG + Intergenic
915751365 1:158213539-158213561 CCATTGGCACACACTGGCTATGG + Intergenic
919262077 1:195208910-195208932 CCAATTTCTCACATTTGGGATGG + Intergenic
920662486 1:207927974-207927996 CCCTTTGAAGATATTGGGGAGGG - Intergenic
921727532 1:218539981-218540003 CCTTCTGGACACATTGGGGTAGG - Intergenic
1066307665 10:34162202-34162224 CCATATGCACACTGGGGGGAAGG + Intronic
1067771310 10:49128389-49128411 CCATTTGCAGACAATAGAGAAGG - Intergenic
1067909337 10:50329821-50329843 CCATCTGCACACACTTGGCAAGG + Intronic
1069100418 10:64313247-64313269 CCATTTGCAAATATAGGGAAAGG - Intergenic
1071513742 10:86283284-86283306 CTATTTGCACAGGTTGGGGAGGG + Intronic
1074031326 10:109691570-109691592 TCATTTGCACTGCTTGGGGATGG - Intergenic
1075237083 10:120740325-120740347 ACATTTGCACACATTGCTGACGG - Intergenic
1075688076 10:124377714-124377736 CCATTTGCACACATGTGAAATGG + Intergenic
1076200901 10:128557183-128557205 CCATTAAAACACGTTGGGGATGG + Intergenic
1076495805 10:130896937-130896959 CCATTCACACAGATTGGGTATGG + Intergenic
1081610486 11:44559900-44559922 CCATTTCCACATCTTGGGAATGG + Intergenic
1083603219 11:63961646-63961668 GCATTTGCACCCATGTGGGACGG - Intergenic
1084703813 11:70804378-70804400 CCATTTGCACACAATTGGCACGG - Intronic
1087358764 11:97130331-97130353 CCAATAACATACATTGGGGAAGG - Intergenic
1088931448 11:114355210-114355232 CCAGTTTCACAATTTGGGGATGG + Intergenic
1089682173 11:120124781-120124803 CCATTTGTGCACCTTGGCGATGG - Intronic
1089907170 11:122052332-122052354 CCAAGAACACACATTGGGGAGGG - Intergenic
1090695754 11:129239775-129239797 CTGTTTGCACAGATTGAGGATGG - Intronic
1092620656 12:10262738-10262760 TCATTTTCAAACATTTGGGATGG + Intergenic
1092702967 12:11253604-11253626 CCCTTTGCAAGCATTGGAGAAGG - Intergenic
1092900601 12:13056064-13056086 CCACCTCCACACAGTGGGGACGG - Intronic
1096538829 12:52291777-52291799 TCATCTGCAGGCATTGGGGAGGG + Intronic
1100216016 12:92449364-92449386 CCATGTGCAGGCATGGGGGATGG + Intergenic
1100894283 12:99161899-99161921 CCATCTGCACAGTTTTGGGATGG - Intronic
1102783953 12:115588710-115588732 CCATTTCCACACAGTGGGCCTGG + Intergenic
1102837528 12:116079392-116079414 CCTTTTGCAGAGATGGGGGAGGG + Intronic
1105068796 12:133221308-133221330 CCAATTGCACGCTCTGGGGATGG + Exonic
1106740322 13:32634312-32634334 ACATGTGCACATATTGGTGAAGG - Intronic
1117832580 14:59767200-59767222 CCATGTCCACACCTAGGGGAAGG - Intronic
1118547019 14:66902783-66902805 GCATTTGTATTCATTGGGGAGGG + Intronic
1119204742 14:72785797-72785819 CCCCTTGCTCACATTTGGGATGG - Intronic
1120699591 14:87684213-87684235 ACACCTGCCCACATTGGGGAAGG + Intergenic
1121422207 14:93824041-93824063 CCATTTTCCCACATGGGAGATGG - Intergenic
1121638493 14:95469813-95469835 CCATTTGCACACATTGGGGAAGG - Intronic
1122047756 14:99035785-99035807 CCGTTTGCTCACATTGGAAATGG - Intergenic
1122318452 14:100839407-100839429 CCATCTGCTCAAATCGGGGATGG - Intergenic
1122867343 14:104613194-104613216 CCATCTGCACACATGAGTGAGGG + Intergenic
1126995947 15:54445212-54445234 CCATTTTCAGACATTTGGGTTGG + Intronic
1129545021 15:76386655-76386677 CCATGTGGACACCTGGGGGAAGG + Intronic
1130157762 15:81367725-81367747 CCAGTTTCACACAATTGGGAAGG + Intronic
1130396005 15:83502214-83502236 CCATTTCCACACACTGATGAGGG - Intronic
1133548558 16:6831762-6831784 CCATTTCCACATCTTTGGGAAGG + Intronic
1134768142 16:16780558-16780580 TCATTAGCCCACATTTGGGAGGG + Intergenic
1138491653 16:57380660-57380682 CCATTTCGAGACTTTGGGGAGGG + Intronic
1142566844 17:845732-845754 CCATTTTCACACATTTGTCATGG + Intronic
1144321164 17:14121623-14121645 TCATTTGCTCTCATTGGAGATGG + Intronic
1148438466 17:47699541-47699563 CAGTCTGCACACAGTGGGGAAGG - Intronic
1148514866 17:48207192-48207214 CCACTTGCACAGGTTGGGCATGG + Intronic
1149629780 17:58112935-58112957 ACATATGTATACATTGGGGAAGG + Intergenic
1151032524 17:70758017-70758039 CCTTTTGGACACACTGGGGTGGG + Intergenic
1155162304 18:23205980-23206002 CCATTTGAAGGCACTGGGGAGGG - Intronic
1156593645 18:38520610-38520632 CACTTTGCAAACACTGGGGAAGG - Intergenic
1156604447 18:38649645-38649667 CCATTTGCATATATAGAGGACGG - Intergenic
1156834743 18:41539121-41539143 CAATTTGCACACATTTTGCAAGG - Intergenic
1158381254 18:56932474-56932496 CCATTTGTTGACATGGGGGAAGG + Intronic
1164673172 19:30084679-30084701 CCATTTCTACACATTGAGGCAGG - Intergenic
1165311673 19:35032275-35032297 CCATTTTCATACATTAGGTAGGG - Intronic
1166331808 19:42082311-42082333 CCTTCTGCATACTTTGGGGAGGG + Intergenic
1167812776 19:51849115-51849137 CTATTTCCACAGTTTGGGGAAGG + Intergenic
926331017 2:11825253-11825275 CCTTCTGAACACAGTGGGGAGGG + Intronic
936552242 2:113455606-113455628 CCATATGCTCAGATTGGGAACGG - Intronic
937921853 2:127136754-127136776 CCATTTCCACCCATAGGGGAAGG + Intergenic
938613228 2:132970894-132970916 ACATTTACACATTTTGGGGAAGG - Intronic
939566559 2:143792433-143792455 CCATTTGCAAACATTTTGAATGG + Intergenic
939580214 2:143937787-143937809 ACATTTGCACACATTGTCAAGGG - Intergenic
940608833 2:155964258-155964280 CCCTTTGCAGACACTGGGAAGGG + Intergenic
942376132 2:175339762-175339784 CCATTTGAGCTCCTTGGGGAAGG - Intergenic
943659817 2:190547285-190547307 CCATTTTCACACATTTATGAAGG - Intergenic
946867033 2:224050684-224050706 CCAAGAGCATACATTGGGGAAGG - Intergenic
947196594 2:227573994-227574016 TCATGTGCCCATATTGGGGAAGG + Intergenic
948360588 2:237417409-237417431 CCATTTGCACGCAAGGGGGGTGG - Intergenic
949042296 2:241854980-241855002 TTATTTGCACACATTGGTGGAGG + Intronic
1169346839 20:4835574-4835596 CCAAGTACACACATAGGGGAAGG - Intergenic
1169992767 20:11522096-11522118 CCATGTGCAGATTTTGGGGAAGG + Intergenic
1170088662 20:12566210-12566232 TCATTTGCAAATATTGGGGTGGG + Intergenic
1170985148 20:21251215-21251237 CAAGTTGCACACCTTGGGGCAGG + Intergenic
1173128338 20:40362028-40362050 CCTCTCGCCCACATTGGGGAGGG - Intergenic
1175506171 20:59485889-59485911 ACATTTGCACACATCAGGGCTGG + Intergenic
1175630709 20:60534210-60534232 CAATTTGCAGAAATTTGGGAAGG - Intergenic
1177956624 21:27606359-27606381 CCATTTGAACTCCTTAGGGAAGG - Intergenic
1182239931 22:28907714-28907736 CCCTTTGCAATCAGTGGGGATGG + Intronic
951205565 3:19922737-19922759 CAATTTGCTCACAATGGAGATGG + Intronic
952986350 3:38788307-38788329 CCATATCCACACATCTGGGAGGG - Intronic
953829078 3:46279869-46279891 CCTTTTACACTCATTGAGGATGG - Intergenic
955090829 3:55749098-55749120 CCTTTTGCACAAATTGGAGGTGG + Intronic
955967851 3:64407328-64407350 CCATGTGTTGACATTGGGGAGGG - Intronic
956743663 3:72294446-72294468 CCATTTGCAAACATTTGGGATGG + Intergenic
959593686 3:108105914-108105936 CCACTTGCACTCATGGCGGAAGG + Intergenic
959803646 3:110525390-110525412 CCATTTTCTCACATTTGGAATGG + Intergenic
961597663 3:128031628-128031650 CCAAGTGCACACAATGGGGAAGG - Intergenic
961631972 3:128307720-128307742 GCCTGTGCACACATTGGGCAGGG + Intronic
966550475 3:181199368-181199390 CCAATTTCTCACTTTGGGGATGG - Intergenic
967634771 3:191788595-191788617 CCAATTTCACAAATTAGGGAAGG + Intergenic
973247116 4:48020754-48020776 ACCTTTGCCCACATTGGGAAAGG + Intronic
977954477 4:103011292-103011314 CCTTCTGCATACAATGGGGAAGG + Intronic
978034118 4:103973573-103973595 ACATTTGAACACATTGTGGAAGG + Intergenic
978206113 4:106083118-106083140 CCATTTGAGCTCCTTGGGGAAGG + Intronic
978710795 4:111778457-111778479 CCATGTGAACATATTGGTGATGG + Intergenic
978856640 4:113401345-113401367 CCATTTTCTCCCATTTGGGATGG + Intergenic
980232527 4:130062780-130062802 CCATTTGCCTTCATTTGGGAAGG + Intergenic
982080135 4:151781474-151781496 CCAATTTCACAAAGTGGGGATGG - Intergenic
982489044 4:156005807-156005829 CCAAGAACACACATTGGGGAAGG + Intergenic
985792394 5:1937146-1937168 CCATCAGCACACCTTGGGGTTGG + Intergenic
986012959 5:3733180-3733202 CAATTTGCACACACTGAGGGTGG - Intergenic
986151890 5:5137418-5137440 TCTTTTGCACACTTTGGAGAGGG - Intergenic
987074137 5:14364990-14365012 CCCTTTTCACACATTAGGGATGG - Intronic
987117431 5:14736827-14736849 CCATTAGCACACAATGGAAATGG - Intronic
987159481 5:15126321-15126343 CCATTTGCACACAATGACAAGGG - Intergenic
987935945 5:24465005-24465027 CCACCTGCACACCGTGGGGACGG + Intergenic
988059465 5:26148738-26148760 CCATTTGAACTCTTTGAGGAAGG + Intergenic
989478365 5:41900371-41900393 CCATATGGAAACATGGGGGAAGG + Intergenic
997303154 5:132821019-132821041 CCCTTTGAACACAGTGGGCAGGG - Intergenic
997796824 5:136818963-136818985 CCCTTTGCACAAATTAGGGCAGG + Intergenic
998853446 5:146372578-146372600 ACATTTGCACACATTAAGGCCGG - Intergenic
1000410956 5:160934727-160934749 CCCTGTCCACACATTTGGGAGGG - Intergenic
1000592537 5:163175967-163175989 CCAGGTGCACACATTGGGAAAGG + Intergenic
1000892328 5:166814852-166814874 ACATTTAGACACACTGGGGAAGG + Intergenic
1001528276 5:172444669-172444691 CCATGTGCAGACAGTGGAGATGG - Intronic
1002015989 5:176323232-176323254 GCATTTGGACAGATTGAGGAAGG + Intronic
1004271567 6:14200723-14200745 CCATGTGCTCACATGGTGGAAGG + Intergenic
1004760066 6:18656564-18656586 CCATTTGAACTCCTTGGGGGAGG + Intergenic
1005967857 6:30740567-30740589 CTATTTGCACTCTTTGGGGAAGG - Exonic
1006153169 6:32000227-32000249 CCCTCTGCACACACTGGGTAGGG - Intronic
1006159477 6:32032964-32032986 CCCTCTGCACACACTGGGTAGGG - Intronic
1006990472 6:38210988-38211010 CCTTTTGCCCAGAATGGGGAAGG - Intronic
1007203697 6:40132125-40132147 CCATTTGCATTCACTTGGGAAGG + Intergenic
1007223566 6:40297180-40297202 CCAATTGCTCCCATTGGGAATGG + Intergenic
1008045748 6:46849661-46849683 CCCTCTGCACACATGGGGCATGG - Intergenic
1008679048 6:53853030-53853052 CCATGTCCTCACATTGTGGAAGG + Intronic
1012092427 6:94916733-94916755 CCTTTTGCACACATGGGATATGG - Intergenic
1014161918 6:118179481-118179503 ACACTTGCCCACATTGGTGAGGG + Intronic
1017436171 6:154417770-154417792 CCATTTGCACACCAAGGAGAGGG + Intronic
1017901812 6:158724505-158724527 CCATTGGAACACAATGGGCAAGG - Intronic
1018705026 6:166457750-166457772 CCAGATGAACACATTGAGGAGGG - Intronic
1019548690 7:1591549-1591571 ACACCTGCCCACATTGGGGAGGG - Intergenic
1021346074 7:19530051-19530073 CTATTTCCACACATTTGTGATGG + Intergenic
1021371903 7:19859530-19859552 ACACATGGACACATTGGGGAGGG + Intergenic
1022738087 7:33094659-33094681 CCACTGGTAGACATTGGGGAAGG + Intergenic
1023354715 7:39355184-39355206 CCATGTGCCCAGATTGGGGAAGG + Intronic
1023621550 7:42078171-42078193 CCATTTCCACCCAGTTGGGATGG - Intronic
1026509184 7:71014113-71014135 AGATTTTCACACATTGGGGTGGG - Intergenic
1029212852 7:98922917-98922939 CCATAAGTAAACATTGGGGAGGG + Intronic
1031278763 7:119767822-119767844 CTATTTTCTAACATTGGGGATGG - Intergenic
1031561876 7:123248679-123248701 ACATTTTCAAATATTGGGGAAGG - Intergenic
1032360612 7:131251508-131251530 CCATTTGAATACCTTGGAGATGG - Intronic
1032600487 7:133288541-133288563 AAATTTGCAAGCATTGGGGAAGG + Intronic
1032905844 7:136364671-136364693 TTATTTGCAAACATAGGGGAAGG + Intergenic
1034930743 7:155161110-155161132 CCATGGGCACACAATGGGGATGG - Intergenic
1036081361 8:5560056-5560078 CCATTTGCACACATTGGTGTGGG + Intergenic
1038388711 8:27174550-27174572 CCCTTTTTACACATTGGGCAAGG + Intergenic
1040017796 8:42714012-42714034 CCATTTGCACAGATTGAGTTTGG + Intronic
1045702827 8:104886607-104886629 GCATATGCCCACACTGGGGAGGG - Intronic
1046383697 8:113481742-113481764 CCAAAAGCACACATTGAGGAAGG - Intergenic
1048617427 8:136092642-136092664 CCATTTGCTCAGAGTGGGGTTGG - Intergenic
1049900764 9:161582-161604 CCATATGCTCAGATTGGGAACGG + Intronic
1049960637 9:734856-734878 CACTTTGTACACACTGGGGATGG - Intronic
1051246603 9:15118071-15118093 CCATGGGCACCCAGTGGGGAAGG - Intergenic
1053743797 9:41171862-41171884 CCATATGCTCAGATTGGGAACGG + Intronic
1054349075 9:64001677-64001699 CCATATGCTCAGATTGGGAACGG + Intergenic
1054483473 9:65693436-65693458 CCATATGCTCAGATTGGGAACGG - Intronic
1054684546 9:68259397-68259419 CCATATGCTCAGATTGGGAACGG - Intronic
1054721976 9:68613331-68613353 CAATTTGCAAACATGGGGGATGG - Intergenic
1055472125 9:76622253-76622275 CCATTTAGACACATTGGGAGAGG + Intronic
1056368383 9:85929322-85929344 TCATTTACAGACATTGAGGAGGG - Intergenic
1058271770 9:102981412-102981434 CCTTCTGGACACATTGGGGTGGG - Intergenic
1059640000 9:116207064-116207086 CCAGTAGCACACATTAGTGATGG - Intronic
1059667053 9:116457082-116457104 CCAAGAACACACATTGGGGAAGG + Intronic
1060053112 9:120391063-120391085 CCATTTGCACACAGTGTCGGAGG - Intronic
1060559775 9:124533482-124533504 CCCTTTGCACAGCTAGGGGAGGG - Intronic
1060920236 9:127415239-127415261 CCATTTGCCTTCAGTGGGGAGGG + Intergenic
1187235414 X:17462817-17462839 CAATTTACAGACATGGGGGAGGG + Intronic
1192723946 X:73728294-73728316 CCATGTGCAAACATTTTGGAAGG - Intergenic
1194334542 X:92629476-92629498 CCTTTTGTACACATTGAGGTGGG + Intergenic
1195147142 X:102029204-102029226 CCATTTGAGCACCTTGGGGGAGG + Intergenic
1198440301 X:136656762-136656784 CCATTTCCACACAGTGAAGATGG - Intronic
1200643020 Y:5746530-5746552 CCTTTTGTACACATTGAGGTGGG + Intergenic
1201903620 Y:19067730-19067752 TCATTTGCATACATTCTGGAGGG - Intergenic
1202031208 Y:20576032-20576054 CTATTTGGTCACATTGGGGTGGG + Intronic