ID: 1121640188

View in Genome Browser
Species Human (GRCh38)
Location 14:95480166-95480188
Sequence CCCAGGGATGTCCCCAGACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121640188_1121640197 -3 Left 1121640188 14:95480166-95480188 CCCTGTCTGGGGACATCCCTGGG No data
Right 1121640197 14:95480186-95480208 GGGGTGTGGCTGCAGGCAGCGGG No data
1121640188_1121640193 -10 Left 1121640188 14:95480166-95480188 CCCTGTCTGGGGACATCCCTGGG No data
Right 1121640193 14:95480179-95480201 CATCCCTGGGGTGTGGCTGCAGG No data
1121640188_1121640196 -4 Left 1121640188 14:95480166-95480188 CCCTGTCTGGGGACATCCCTGGG No data
Right 1121640196 14:95480185-95480207 TGGGGTGTGGCTGCAGGCAGCGG No data
1121640188_1121640200 13 Left 1121640188 14:95480166-95480188 CCCTGTCTGGGGACATCCCTGGG No data
Right 1121640200 14:95480202-95480224 CAGCGGGAGAGTAGGGCTCTAGG No data
1121640188_1121640198 5 Left 1121640188 14:95480166-95480188 CCCTGTCTGGGGACATCCCTGGG No data
Right 1121640198 14:95480194-95480216 GCTGCAGGCAGCGGGAGAGTAGG No data
1121640188_1121640199 6 Left 1121640188 14:95480166-95480188 CCCTGTCTGGGGACATCCCTGGG No data
Right 1121640199 14:95480195-95480217 CTGCAGGCAGCGGGAGAGTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121640188 Original CRISPR CCCAGGGATGTCCCCAGACA GGG (reversed) Intergenic
No off target data available for this crispr