ID: 1121642629

View in Genome Browser
Species Human (GRCh38)
Location 14:95495929-95495951
Sequence CTTGAGAGGCCCACTGGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121642629_1121642638 24 Left 1121642629 14:95495929-95495951 CCTTCCCCAGTGGGCCTCTCAAG No data
Right 1121642638 14:95495976-95495998 AGAGCACCTTGACAGGGCAGCGG No data
1121642629_1121642636 17 Left 1121642629 14:95495929-95495951 CCTTCCCCAGTGGGCCTCTCAAG No data
Right 1121642636 14:95495969-95495991 ATCAGGCAGAGCACCTTGACAGG No data
1121642629_1121642635 0 Left 1121642629 14:95495929-95495951 CCTTCCCCAGTGGGCCTCTCAAG No data
Right 1121642635 14:95495952-95495974 AGTATGGCTTGAAATGAATCAGG No data
1121642629_1121642637 18 Left 1121642629 14:95495929-95495951 CCTTCCCCAGTGGGCCTCTCAAG No data
Right 1121642637 14:95495970-95495992 TCAGGCAGAGCACCTTGACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121642629 Original CRISPR CTTGAGAGGCCCACTGGGGA AGG (reversed) Intergenic
No off target data available for this crispr