ID: 1121643974

View in Genome Browser
Species Human (GRCh38)
Location 14:95505128-95505150
Sequence CCGGCTCCTTCACTTGTGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121643974_1121643979 -6 Left 1121643974 14:95505128-95505150 CCAAGCACAAGTGAAGGAGCCGG No data
Right 1121643979 14:95505145-95505167 AGCCGGGCTCCTGTGGGCACCGG No data
1121643974_1121643980 -5 Left 1121643974 14:95505128-95505150 CCAAGCACAAGTGAAGGAGCCGG No data
Right 1121643980 14:95505146-95505168 GCCGGGCTCCTGTGGGCACCGGG No data
1121643974_1121643982 -4 Left 1121643974 14:95505128-95505150 CCAAGCACAAGTGAAGGAGCCGG No data
Right 1121643982 14:95505147-95505169 CCGGGCTCCTGTGGGCACCGGGG No data
1121643974_1121643986 27 Left 1121643974 14:95505128-95505150 CCAAGCACAAGTGAAGGAGCCGG No data
Right 1121643986 14:95505178-95505200 TTGCATTCGCTGAGTTTACGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121643974 Original CRISPR CCGGCTCCTTCACTTGTGCT TGG (reversed) Intergenic
No off target data available for this crispr