ID: 1121645316

View in Genome Browser
Species Human (GRCh38)
Location 14:95514383-95514405
Sequence GTCCTGGCTCACCCCCCTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121645316_1121645318 -1 Left 1121645316 14:95514383-95514405 CCATGAGGGGGGTGAGCCAGGAC No data
Right 1121645318 14:95514405-95514427 CTACCCACCATTGACAGACAAGG No data
1121645316_1121645327 23 Left 1121645316 14:95514383-95514405 CCATGAGGGGGGTGAGCCAGGAC No data
Right 1121645327 14:95514429-95514451 GAAATCAAGGCAGGGAGAAGAGG No data
1121645316_1121645326 15 Left 1121645316 14:95514383-95514405 CCATGAGGGGGGTGAGCCAGGAC No data
Right 1121645326 14:95514421-95514443 GACAAGGGGAAATCAAGGCAGGG No data
1121645316_1121645325 14 Left 1121645316 14:95514383-95514405 CCATGAGGGGGGTGAGCCAGGAC No data
Right 1121645325 14:95514420-95514442 AGACAAGGGGAAATCAAGGCAGG No data
1121645316_1121645329 25 Left 1121645316 14:95514383-95514405 CCATGAGGGGGGTGAGCCAGGAC No data
Right 1121645329 14:95514431-95514453 AATCAAGGCAGGGAGAAGAGGGG No data
1121645316_1121645319 0 Left 1121645316 14:95514383-95514405 CCATGAGGGGGGTGAGCCAGGAC No data
Right 1121645319 14:95514406-95514428 TACCCACCATTGACAGACAAGGG No data
1121645316_1121645328 24 Left 1121645316 14:95514383-95514405 CCATGAGGGGGGTGAGCCAGGAC No data
Right 1121645328 14:95514430-95514452 AAATCAAGGCAGGGAGAAGAGGG No data
1121645316_1121645320 1 Left 1121645316 14:95514383-95514405 CCATGAGGGGGGTGAGCCAGGAC No data
Right 1121645320 14:95514407-95514429 ACCCACCATTGACAGACAAGGGG No data
1121645316_1121645324 10 Left 1121645316 14:95514383-95514405 CCATGAGGGGGGTGAGCCAGGAC No data
Right 1121645324 14:95514416-95514438 TGACAGACAAGGGGAAATCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121645316 Original CRISPR GTCCTGGCTCACCCCCCTCA TGG (reversed) Intergenic
No off target data available for this crispr