ID: 1121647092

View in Genome Browser
Species Human (GRCh38)
Location 14:95525935-95525957
Sequence TCTGATGACCCTCTCCTAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121647084_1121647092 5 Left 1121647084 14:95525907-95525929 CCCCACCCCAATACCTGCAAAGG No data
Right 1121647092 14:95525935-95525957 TCTGATGACCCTCTCCTAAGTGG No data
1121647081_1121647092 12 Left 1121647081 14:95525900-95525922 CCCATGCCCCCACCCCAATACCT No data
Right 1121647092 14:95525935-95525957 TCTGATGACCCTCTCCTAAGTGG No data
1121647086_1121647092 4 Left 1121647086 14:95525908-95525930 CCCACCCCAATACCTGCAAAGGT No data
Right 1121647092 14:95525935-95525957 TCTGATGACCCTCTCCTAAGTGG No data
1121647087_1121647092 3 Left 1121647087 14:95525909-95525931 CCACCCCAATACCTGCAAAGGTT No data
Right 1121647092 14:95525935-95525957 TCTGATGACCCTCTCCTAAGTGG No data
1121647080_1121647092 13 Left 1121647080 14:95525899-95525921 CCCCATGCCCCCACCCCAATACC No data
Right 1121647092 14:95525935-95525957 TCTGATGACCCTCTCCTAAGTGG No data
1121647088_1121647092 0 Left 1121647088 14:95525912-95525934 CCCCAATACCTGCAAAGGTTAAA No data
Right 1121647092 14:95525935-95525957 TCTGATGACCCTCTCCTAAGTGG No data
1121647090_1121647092 -2 Left 1121647090 14:95525914-95525936 CCAATACCTGCAAAGGTTAAATC No data
Right 1121647092 14:95525935-95525957 TCTGATGACCCTCTCCTAAGTGG No data
1121647083_1121647092 6 Left 1121647083 14:95525906-95525928 CCCCCACCCCAATACCTGCAAAG No data
Right 1121647092 14:95525935-95525957 TCTGATGACCCTCTCCTAAGTGG No data
1121647082_1121647092 11 Left 1121647082 14:95525901-95525923 CCATGCCCCCACCCCAATACCTG No data
Right 1121647092 14:95525935-95525957 TCTGATGACCCTCTCCTAAGTGG No data
1121647089_1121647092 -1 Left 1121647089 14:95525913-95525935 CCCAATACCTGCAAAGGTTAAAT No data
Right 1121647092 14:95525935-95525957 TCTGATGACCCTCTCCTAAGTGG No data
1121647078_1121647092 18 Left 1121647078 14:95525894-95525916 CCTTCCCCCATGCCCCCACCCCA 0: 18
1: 537
2: 9004
3: 9842
4: 9362
Right 1121647092 14:95525935-95525957 TCTGATGACCCTCTCCTAAGTGG No data
1121647091_1121647092 -8 Left 1121647091 14:95525920-95525942 CCTGCAAAGGTTAAATCTGATGA No data
Right 1121647092 14:95525935-95525957 TCTGATGACCCTCTCCTAAGTGG No data
1121647079_1121647092 14 Left 1121647079 14:95525898-95525920 CCCCCATGCCCCCACCCCAATAC No data
Right 1121647092 14:95525935-95525957 TCTGATGACCCTCTCCTAAGTGG No data
1121647077_1121647092 19 Left 1121647077 14:95525893-95525915 CCCTTCCCCCATGCCCCCACCCC No data
Right 1121647092 14:95525935-95525957 TCTGATGACCCTCTCCTAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121647092 Original CRISPR TCTGATGACCCTCTCCTAAG TGG Intergenic
No off target data available for this crispr