ID: 1121648226

View in Genome Browser
Species Human (GRCh38)
Location 14:95535446-95535468
Sequence GCCGAGGGGTTCCGCCGCGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 49
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 47}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121648219_1121648226 4 Left 1121648219 14:95535419-95535441 CCGGGCCCAGGAGCATCGCTGCA 0: 1
1: 0
2: 2
3: 15
4: 176
Right 1121648226 14:95535446-95535468 GCCGAGGGGTTCCGCCGCGCCGG 0: 1
1: 0
2: 0
3: 1
4: 47
1121648216_1121648226 9 Left 1121648216 14:95535414-95535436 CCGCCCCGGGCCCAGGAGCATCG 0: 1
1: 0
2: 0
3: 11
4: 161
Right 1121648226 14:95535446-95535468 GCCGAGGGGTTCCGCCGCGCCGG 0: 1
1: 0
2: 0
3: 1
4: 47
1121648218_1121648226 5 Left 1121648218 14:95535418-95535440 CCCGGGCCCAGGAGCATCGCTGC 0: 1
1: 0
2: 0
3: 26
4: 255
Right 1121648226 14:95535446-95535468 GCCGAGGGGTTCCGCCGCGCCGG 0: 1
1: 0
2: 0
3: 1
4: 47
1121648214_1121648226 13 Left 1121648214 14:95535410-95535432 CCCTCCGCCCCGGGCCCAGGAGC 0: 1
1: 0
2: 2
3: 29
4: 331
Right 1121648226 14:95535446-95535468 GCCGAGGGGTTCCGCCGCGCCGG 0: 1
1: 0
2: 0
3: 1
4: 47
1121648220_1121648226 -1 Left 1121648220 14:95535424-95535446 CCCAGGAGCATCGCTGCACGAGG 0: 1
1: 0
2: 0
3: 2
4: 69
Right 1121648226 14:95535446-95535468 GCCGAGGGGTTCCGCCGCGCCGG 0: 1
1: 0
2: 0
3: 1
4: 47
1121648215_1121648226 12 Left 1121648215 14:95535411-95535433 CCTCCGCCCCGGGCCCAGGAGCA 0: 1
1: 0
2: 5
3: 73
4: 837
Right 1121648226 14:95535446-95535468 GCCGAGGGGTTCCGCCGCGCCGG 0: 1
1: 0
2: 0
3: 1
4: 47
1121648210_1121648226 24 Left 1121648210 14:95535399-95535421 CCGGGCAGGCGCCCTCCGCCCCG 0: 1
1: 0
2: 3
3: 42
4: 330
Right 1121648226 14:95535446-95535468 GCCGAGGGGTTCCGCCGCGCCGG 0: 1
1: 0
2: 0
3: 1
4: 47
1121648217_1121648226 6 Left 1121648217 14:95535417-95535439 CCCCGGGCCCAGGAGCATCGCTG 0: 1
1: 0
2: 0
3: 14
4: 171
Right 1121648226 14:95535446-95535468 GCCGAGGGGTTCCGCCGCGCCGG 0: 1
1: 0
2: 0
3: 1
4: 47
1121648222_1121648226 -2 Left 1121648222 14:95535425-95535447 CCAGGAGCATCGCTGCACGAGGC 0: 1
1: 0
2: 0
3: 2
4: 66
Right 1121648226 14:95535446-95535468 GCCGAGGGGTTCCGCCGCGCCGG 0: 1
1: 0
2: 0
3: 1
4: 47

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121648226 Original CRISPR GCCGAGGGGTTCCGCCGCGC CGG Intronic
905741428 1:40374244-40374266 GGCCAGGGGTCCAGCCGCGCCGG + Intronic
908355784 1:63323852-63323874 GCCGTAGGGTCCCGCGGCGCCGG - Exonic
920655215 1:207869210-207869232 GCCGCTGGGTGGCGCCGCGCGGG - Intergenic
923429229 1:233904950-233904972 ACCGAGGGTCTGCGCCGCGCCGG - Exonic
1065215007 10:23439929-23439951 GCCGAGGAGCCCCGCCGCGGCGG - Exonic
1075741775 10:124700372-124700394 GCCGAGGGGTTCCCTCGGCCTGG - Intronic
1085739894 11:79069721-79069743 GCCGAGGAATTCTGCCGCACAGG - Exonic
1103623610 12:122203610-122203632 GCCGCGGGTCTCCGCAGCGCCGG - Exonic
1103988107 12:124780597-124780619 GCCTAGGGGATCCGGGGCGCTGG + Intronic
1121648226 14:95535446-95535468 GCCGAGGGGTTCCGCCGCGCCGG + Intronic
1122789044 14:104176706-104176728 GCGGAGGGGTGCCACCACGCTGG + Exonic
1129082274 15:73052046-73052068 GCCGAGGGGCTGCGGCGAGCGGG + Intronic
1129504021 15:76065958-76065980 GCCGAGGGGTGCCCCTGCCCAGG + Intronic
1133288918 16:4705104-4705126 GCCGTGGGGCTCTGCCGCCCAGG + Exonic
1139917925 16:70439398-70439420 GCTCAGGGGGTCCGCCGTGCAGG + Intergenic
1148742760 17:49902069-49902091 GGCGAGGGGCTCCGGCGCGGCGG + Intergenic
1151674100 17:75589120-75589142 GCCGTGGGCCCCCGCCGCGCTGG + Intergenic
1151919351 17:77141458-77141480 CCCGTGGGGCTCAGCCGCGCGGG + Intronic
1152740730 17:82017222-82017244 GCCGAGTGCTTCAGCCGGGCTGG + Intronic
1156871895 18:41955128-41955150 GGCGGGGAGTTCCGCCGCGTCGG + Intergenic
927542749 2:23927220-23927242 GCCGAGCGCTGACGCCGCGCCGG - Intergenic
937933053 2:127220186-127220208 GCCGCGGGGCCCCGCCGCCCAGG + Intergenic
941951321 2:171160226-171160248 GGCGCGGGGGTCCGCGGCGCGGG + Intronic
947741208 2:232485787-232485809 GCCCAGGGGTCCCTGCGCGCGGG - Intronic
1168951320 20:1803828-1803850 CCTGAGGGTTTCCGCGGCGCCGG - Intergenic
1171175505 20:23048848-23048870 GCCGAGGGGAGCCACCGCGGCGG + Exonic
1171512552 20:25696942-25696964 ACCGAGGGGATGCGACGCGCAGG - Intergenic
1173813822 20:45972187-45972209 GCCGATGGGTTCCTCCGCAGCGG - Intergenic
1175866838 20:62183138-62183160 GCCGCGGGGTACCGGGGCGCTGG + Intronic
1176178813 20:63740293-63740315 GCCGAGCGGATCCGCGGCGGAGG + Intronic
1178913371 21:36693632-36693654 GGTCAGAGGTTCCGCCGCGCAGG - Intergenic
1181256850 22:21568165-21568187 GCGGGGCGGTTCCGCGGCGCGGG - Intronic
949414304 3:3799546-3799568 GCCTAGGGATGCCGCCGCCCGGG - Exonic
950487755 3:13282956-13282978 GCCGGGGGGCTCGGCGGCGCTGG + Intergenic
969288350 4:6222272-6222294 GCCGAGCGGTTCCGGTGCGCTGG + Intergenic
990383043 5:55233942-55233964 GCCAAGCGGCTCCGCTGCGCCGG + Intergenic
993900062 5:93579247-93579269 GCCGCGGGCTTCCGCTGCTCCGG + Intergenic
1001315584 5:170639015-170639037 GCAGAGGTGTTCCGCCCCGGAGG - Intronic
1002193773 5:177491693-177491715 GCCGCACGGTTCCGCCGGGCTGG + Intronic
1012237683 6:96837516-96837538 GCCGAGGGGTTCCCGCCCCCAGG + Intergenic
1035737840 8:1901626-1901648 GCCGGGGGCATCCGCCGGGCTGG - Intronic
1037836263 8:22216459-22216481 GGTGAGGGGTTCCGCTGTGCAGG - Intergenic
1039060275 8:33567021-33567043 GCCGAGGGCTTCTGCAGCCCGGG - Exonic
1040323339 8:46329267-46329289 GCCAAGGGGTTCCCCCCGGCTGG - Intergenic
1050284977 9:4091760-4091782 GAAGAGGGGTTCCGCAGGGCTGG - Intronic
1060140052 9:121201769-121201791 GCCGAGAGGTGCAGACGCGCCGG + Exonic
1060812700 9:126618998-126619020 GCCGAGAGGCTCGGCCGCCCGGG - Intronic
1188154278 X:26722374-26722396 GCTGAGGGGCTCTGCTGCGCTGG - Intergenic
1191878589 X:65822174-65822196 GACGCGGGGATCCGGCGCGCCGG + Intergenic