ID: 1121648410

View in Genome Browser
Species Human (GRCh38)
Location 14:95536409-95536431
Sequence TTTTTAGCTAGGGACATGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 128}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121648410_1121648415 5 Left 1121648410 14:95536409-95536431 CCCTGCATGTCCCTAGCTAAAAA 0: 1
1: 0
2: 0
3: 6
4: 128
Right 1121648415 14:95536437-95536459 GCCAGTTGTGTGCTAAAAATAGG 0: 1
1: 0
2: 0
3: 13
4: 120
1121648410_1121648417 12 Left 1121648410 14:95536409-95536431 CCCTGCATGTCCCTAGCTAAAAA 0: 1
1: 0
2: 0
3: 6
4: 128
Right 1121648417 14:95536444-95536466 GTGTGCTAAAAATAGGTGCCAGG 0: 1
1: 0
2: 0
3: 9
4: 122

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121648410 Original CRISPR TTTTTAGCTAGGGACATGCA GGG (reversed) Intronic
900676500 1:3890376-3890398 TTCTCAGCTCGGGAGATGCAGGG + Intronic
900773788 1:4566373-4566395 TCTTGAGCAAGGGAGATGCATGG - Intergenic
907731151 1:57067254-57067276 TTTTTAGATAGTGACTTGAAAGG + Intronic
910220393 1:84884134-84884156 TTTTTAGATAGGTAAAGGCAAGG - Intronic
913217600 1:116633514-116633536 TATATAGTTAGGGAAATGCAGGG - Intronic
916927258 1:169535218-169535240 TTTTTATCTAGTGAAATCCAGGG + Intronic
917365593 1:174228905-174228927 ATTTTAGGTAGGGGCATGAAGGG + Intronic
919604688 1:199667499-199667521 TTTGTAGATAGGGATATACAGGG + Intergenic
921949564 1:220915366-220915388 TTTTGAGCTAGGCATGTGCAGGG + Intergenic
923830471 1:237550065-237550087 TTTTCAGTTAGGGACATAGAAGG + Intronic
924355880 1:243175702-243175724 ATTTCACCTAGGAACATGCAAGG + Intronic
1063475870 10:6328547-6328569 TTTTTACATATGTACATGCAAGG - Intergenic
1064941516 10:20740726-20740748 TTTTTAGCCAGGAAGATTCAGGG + Intergenic
1065477411 10:26155219-26155241 TTTTTAGCTCTGTACAGGCAGGG - Intronic
1065976963 10:30850058-30850080 TTTTCAGGTAGGGACATTCTGGG + Exonic
1066591717 10:37001964-37001986 TTGATAGCAAGGGACATTCAGGG + Intergenic
1067675199 10:48368641-48368663 TTTTAAGCAAGGGAGATTCAGGG + Intronic
1068920682 10:62480227-62480249 TATTTAGCTTGGGACATGGCAGG + Intronic
1071777760 10:88808169-88808191 TGATTAGCTAGGGAAAAGCAAGG + Intronic
1072237071 10:93462570-93462592 TTATTAGCTAGGGAAATGGGAGG - Intronic
1072942743 10:99781647-99781669 TTTTTAGCTAGGATACTGCATGG + Intergenic
1073665186 10:105523971-105523993 TATTTAGCTATGGATATGTAGGG + Intergenic
1075839783 10:125491143-125491165 TTTTAACCCAGGGACATTCACGG - Intergenic
1076484352 10:130806360-130806382 TTGATAGCAAGGGACTTGCAGGG + Intergenic
1078897163 11:15606909-15606931 TTCCAAGCTAGGCACATGCAAGG + Intergenic
1082932491 11:58623217-58623239 TTTTTAGCTATGTAAATGAAAGG + Intronic
1090190784 11:124765902-124765924 TTTTTTGGTAGAGACATGGATGG - Intergenic
1090525281 11:127527740-127527762 TATTAAGCTATGGACATTCATGG + Intergenic
1096331341 12:50715798-50715820 TTTTTAGCTGGACACATGCCTGG - Intronic
1097170486 12:57110188-57110210 TTTCTAGCCAGGGCCATGCCAGG - Intronic
1099233307 12:80052561-80052583 CTTTAAGGTAGAGACATGCAGGG - Intergenic
1102834153 12:116038221-116038243 TTTAAAGATAGGGACAAGCAAGG + Intronic
1103815547 12:123652417-123652439 TTCTTAGCTAGGTAGATGCTGGG + Intronic
1104085375 12:125470060-125470082 GTTATAGCTGGGGACATCCATGG + Intronic
1110165845 13:72442171-72442193 TTTTTAATTTGGGGCATGCAGGG - Intergenic
1111233458 13:85375391-85375413 TTTTTATCTTGGGACATTCCGGG - Intergenic
1111652998 13:91116167-91116189 ATTTTAGCTATGTCCATGCAGGG + Intergenic
1112957915 13:105084358-105084380 CATTTACCTAGGGACATGGACGG - Intergenic
1114793943 14:25691164-25691186 TTACTAGCTAAGGAAATGCAGGG - Intergenic
1116216059 14:42018885-42018907 TTTACAGCTATGAACATGCAAGG - Intergenic
1120720386 14:87884111-87884133 TTTTTTTCTAGAGACATGAAGGG + Intronic
1121555321 14:94832092-94832114 TTGTTAGCTAGGTAACTGCAAGG + Intergenic
1121648410 14:95536409-95536431 TTTTTAGCTAGGGACATGCAGGG - Intronic
1124632734 15:31346743-31346765 TTTCTAGCGAGGGACATCCCAGG + Intronic
1127083275 15:55401354-55401376 TTTTTAGGGAGGGACAGGGAAGG - Intronic
1127735200 15:61832882-61832904 TTTTTTGATAGGGAAAAGCAGGG - Intergenic
1133882298 16:9794205-9794227 CTTTTTCCTAGGGAAATGCATGG + Intronic
1143897535 17:10147964-10147986 TTTTCAGCTGGGGACATGGGAGG - Intronic
1145288812 17:21526797-21526819 ATTTTAACTGGGGACCTGCAAGG + Intronic
1147435951 17:40415342-40415364 TGTTGAGCTAGGGCCAGGCACGG - Intronic
1157573331 18:48728031-48728053 TTTTTAGCCAGGGTCCTGCAGGG - Intronic
1159196249 18:65119633-65119655 TTTTCAGCTAGGATCATGCATGG - Intergenic
1162531816 19:11240412-11240434 GTTTTGTCTGGGGACATGCAGGG - Intronic
1167016573 19:46844809-46844831 TTTTTAAAGAGGGACAGGCATGG + Intronic
925490335 2:4385329-4385351 TTTTAAGTTCCGGACATGCAGGG + Intergenic
925559591 2:5175795-5175817 TTTTTGCCTTGGGTCATGCAGGG - Intergenic
925959024 2:8997501-8997523 TTTTTAGGAAGGGAAATACAAGG - Intronic
927104684 2:19812977-19812999 CTTTTAGCTTGGGAGATCCATGG - Intergenic
928065474 2:28160303-28160325 TTTTTAGCTGGGCCCGTGCATGG + Intronic
933091621 2:78126366-78126388 TTTTTAGCTTGGGTAAAGCATGG - Intergenic
936486582 2:112930977-112930999 TCCTTAGCTATGGACATGCAAGG - Intergenic
940018193 2:149129157-149129179 TTATCTGCCAGGGACATGCAAGG + Intronic
941193655 2:162419257-162419279 TTTTTAGCCTGGGACATTAATGG - Intronic
944069706 2:195655338-195655360 TTTTTAGTTATGGATATACAAGG - Intronic
948919947 2:241060470-241060492 TTTATAGTTAGGGACGGGCATGG - Intronic
1178623071 21:34193326-34193348 TTTAAAGATAGGGACATGGATGG + Intergenic
1180016690 21:45090864-45090886 TTTGTAGATAGCGAAATGCAGGG + Intronic
1180818910 22:18811585-18811607 TATATAGTTAGGGAAATGCAGGG - Intergenic
1181205134 22:21246040-21246062 TATATAGTTAGGGAAATGCAGGG - Intergenic
1181788866 22:25247491-25247513 CTTTTAGCTTTAGACATGCAAGG - Intergenic
1203221791 22_KI270731v1_random:49375-49397 TATATAGTTAGGGAAATGCAGGG + Intergenic
1203269035 22_KI270734v1_random:37438-37460 TATATAGTTAGGGAAATGCAGGG - Intergenic
950715251 3:14843340-14843362 TTTTTAGCTCGGGAAAGTCAAGG + Intronic
950726443 3:14920165-14920187 TCTTCAGCCAGGGACGTGCATGG + Intronic
951074042 3:18367558-18367580 TTATTAGATAGGGACCTGGAAGG + Intronic
952025523 3:29076442-29076464 TTTTTAGCATGTGATATGCATGG + Intergenic
952756545 3:36873834-36873856 TTTTTTGCTGTGTACATGCATGG + Intronic
959572478 3:107899762-107899784 TTTTCAGCAAGGGAGATGGAAGG - Intergenic
963089090 3:141465191-141465213 TTTTTAGTTAGGGACTTTAAAGG + Intergenic
963207737 3:142653652-142653674 TTCTGAGCTAGGGCCAGGCATGG - Intronic
965240288 3:166188475-166188497 TTTTTTGCCAGGGACATTGATGG + Intergenic
966457401 3:180133371-180133393 TTTTTAACTGTGGACATGCCTGG + Intergenic
966795562 3:183709968-183709990 TTTTTATCTCGGGTCAGGCATGG - Intronic
970788702 4:19830867-19830889 TTGGTAGCTAAGGACAGGCAGGG + Intergenic
971485904 4:27159942-27159964 TCTTTAGCCAGATACATGCATGG + Intergenic
974233280 4:59145892-59145914 TTCTTTGCAAGGGACATGAATGG - Intergenic
975040572 4:69740389-69740411 GTTTTAGCAAGGGAAATGCCAGG + Intronic
975693780 4:76991664-76991686 TTTTTGTCTAGGGAAATTCAGGG - Intronic
976241168 4:82958370-82958392 GTTTTAGCTAGTGAAATGAATGG + Intronic
977740020 4:100468213-100468235 TTTTCACCTAAGGACATGCTTGG - Intronic
977946097 4:102915962-102915984 TTTTTTGGTAGGGGCATGCTTGG - Intronic
984040923 4:174732895-174732917 TGATTAGCTAGGGAAATGCTGGG + Intronic
984580660 4:181506330-181506352 TTTTTACTCAGTGACATGCATGG + Intergenic
987120220 5:14760258-14760280 GTTATAGCAAGGGACATGGATGG + Intronic
987654355 5:20786632-20786654 TTGTTAGATATGGATATGCATGG - Intergenic
988741278 5:34075178-34075200 TTGTTAGATATGGATATGCATGG + Intronic
989618738 5:43363962-43363984 TTTTTCTCTAGGCAGATGCAGGG - Intergenic
990894131 5:60679090-60679112 TTTTTATTTTGGCACATGCATGG + Intronic
993258940 5:85633173-85633195 TTGTTAGCTAGGCAAATGTAAGG + Intergenic
993538573 5:89119402-89119424 TTTTTAGCAAGGGAACTGGATGG + Intergenic
994276411 5:97843725-97843747 TTTTTAACTTAGGACATGCCAGG + Intergenic
999474369 5:151884987-151885009 TTGTTAGCTAGGAACAAACATGG - Intronic
1001235978 5:170029934-170029956 TGTTTAGTGAGGGCCATGCATGG - Intronic
1001503805 5:172260366-172260388 TTTTCAGCTGGGGACAAGGATGG - Intronic
1008876081 6:56329589-56329611 TTTTCAGCTGAGAACATGCATGG + Intronic
1009276705 6:61690942-61690964 GTTTTAGATAGCCACATGCATGG - Intronic
1013940386 6:115653945-115653967 ATTTTAGTTAATGACATGCATGG - Intergenic
1017038897 6:150291739-150291761 TTTTTGGCTTGGGCAATGCAGGG + Intergenic
1018231888 6:161683052-161683074 TTTTTAGGGAGGAGCATGCATGG + Intronic
1021658577 7:22896107-22896129 TTTTTGGCTAGGGGGAAGCAAGG - Intergenic
1023793293 7:43770759-43770781 TTTTTAAATGGGGACAAGCAAGG - Intronic
1028569618 7:92272238-92272260 TTTATAGCTATGGAGATCCATGG + Intronic
1034709913 7:153182319-153182341 TTATTTGCTAGGCACATTCATGG - Intergenic
1037279099 8:17215878-17215900 TTGTTAGCAAGGAACAAGCAAGG + Intronic
1043128728 8:76433822-76433844 TTTTTAGTTATGGACACACAAGG - Intergenic
1045011453 8:97962417-97962439 TTCTTAGCTAGGGATGTGGAAGG + Intronic
1045065557 8:98440765-98440787 TTTTGAGAAAGGGAAATGCACGG - Intronic
1047947596 8:129897638-129897660 TTTCTAGGTAGGGAGAGGCATGG + Intronic
1050380566 9:5023964-5023986 TTTTTAGCTTGGGCCGGGCACGG + Intronic
1050471710 9:5999527-5999549 TTTTAAGCTAGGGAATTACAAGG - Intronic
1052938125 9:34110524-34110546 TTTTTAGTTGGGGACTGGCATGG - Intronic
1054813158 9:69450842-69450864 TTTGGACATAGGGACATGCATGG + Intronic
1058010380 9:99970227-99970249 TCTTTAGACAGGGACATGAAAGG - Exonic
1058462831 9:105198668-105198690 TTTTTAGTTAGGGCCAGGCATGG - Intergenic
1059200486 9:112410634-112410656 TTATTAGTTAGGGCCAGGCATGG + Intronic
1186748235 X:12592896-12592918 TTTTTAACACAGGACATGCAAGG - Intronic
1188216735 X:27488222-27488244 TTTTTAGGAGGGGAAATGCAAGG - Intergenic
1188232362 X:27680275-27680297 TTATTACCTTGGGACTTGCAGGG - Intronic
1190017405 X:46839259-46839281 TTTTTTTCTAGGGCCAGGCATGG + Intronic
1190479166 X:50858669-50858691 TTTTGAGCTATGGACATTCAAGG - Intergenic
1193895270 X:87107409-87107431 TTTTTAGCTATTGACATGTTAGG - Intergenic
1193985856 X:88239021-88239043 TTTTTATCTAGGGGTATGTATGG + Intergenic
1194693369 X:97013881-97013903 TTAATAGCTATGGACATACAAGG + Intronic
1195369211 X:104156625-104156647 TTTTTAGCTGGGGACAGGCGGGG - Intronic
1198520608 X:137448827-137448849 CTTTGTGCAAGGGACATGCAGGG - Intergenic