ID: 1121648833

View in Genome Browser
Species Human (GRCh38)
Location 14:95540525-95540547
Sequence GGCACGGGGCAGAGTGGGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 636
Summary {0: 1, 1: 4, 2: 9, 3: 59, 4: 563}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121648833_1121648841 -2 Left 1121648833 14:95540525-95540547 CCTTGCCCACTCTGCCCCGTGCC 0: 1
1: 4
2: 9
3: 59
4: 563
Right 1121648841 14:95540546-95540568 CCTTGCTTTTCCTCTAGTGAGGG 0: 1
1: 0
2: 2
3: 14
4: 211
1121648833_1121648839 -3 Left 1121648833 14:95540525-95540547 CCTTGCCCACTCTGCCCCGTGCC 0: 1
1: 4
2: 9
3: 59
4: 563
Right 1121648839 14:95540545-95540567 GCCTTGCTTTTCCTCTAGTGAGG 0: 1
1: 0
2: 0
3: 20
4: 167

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121648833 Original CRISPR GGCACGGGGCAGAGTGGGCA AGG (reversed) Intronic
900032662 1:382126-382148 GGACGGGGGCAGAGTCGGCAGGG - Intergenic
900053420 1:611188-611210 GGACGGGGGCAGAGTCGGCAGGG - Intergenic
900586991 1:3437404-3437426 GGGACGGGACAGAGGGGGCAGGG - Exonic
900592301 1:3465481-3465503 GGCACGGGGCTGAGGGTGCCAGG + Intronic
900601176 1:3503255-3503277 GGCACTGGGCAGTGTGCACAGGG + Intronic
900711724 1:4118833-4118855 GGAAGGGGGCTGAGGGGGCATGG + Intergenic
900951037 1:5858443-5858465 GGCAGGGGGTCGAGTGGGCCAGG - Intergenic
901162215 1:7187126-7187148 GGCACAGGGCAGGGTGGGTGCGG + Intronic
901219405 1:7574660-7574682 GGCACGGGACAGAGCTGGCCAGG - Intronic
901225862 1:7612658-7612680 GGCAGGGGTCACAGTGTGCATGG + Intronic
901796799 1:11684183-11684205 GGCAGGGGGCCGAGTCAGCATGG + Intronic
902683264 1:18058724-18058746 GGGACGGGGCTGGGTGAGCAGGG - Intergenic
903013047 1:20343881-20343903 GGCACTGAGCAGAATGGGGAGGG - Intronic
903120715 1:21215408-21215430 GGCACGGAGCTGGGTGGGGAGGG + Intergenic
903295516 1:22340908-22340930 GGCAAGGGGTAGAAAGGGCATGG + Intergenic
903657753 1:24959447-24959469 GGCAAGCGCCATAGTGGGCACGG + Intronic
903695413 1:25202633-25202655 GACACGGGACAGAGTGACCAAGG - Intergenic
903907798 1:26697811-26697833 GGTGCGGGGCAGAGTGTGCGGGG + Intronic
904642967 1:31944496-31944518 GGGGCGGGGCGGAGGGGGCAGGG + Intronic
904824497 1:33265619-33265641 GGCAGAGGGCAGAGGGGCCATGG + Intronic
904842118 1:33379394-33379416 GGCAAGGGGGACAGTGGGCAGGG - Intronic
904985802 1:34547443-34547465 GGGAAGGGGCAGGGAGGGCAGGG + Intergenic
905019065 1:34796015-34796037 GGCATGGGGGAGGGAGGGCAAGG - Intronic
905019077 1:34796046-34796068 TGCAGGGGGCAGTGTGGCCAGGG - Intronic
905301596 1:36989657-36989679 GCCACGGGAGAGACTGGGCAGGG - Intronic
906322682 1:44826816-44826838 AGCACGGGGCAGAGTGGGCAGGG + Intronic
906647748 1:47488061-47488083 GGCATGGGGCAGGGTGAGCCAGG + Intergenic
907222978 1:52921130-52921152 GGCAGCGGGCAGAGTGAGGAGGG - Intronic
907280863 1:53346326-53346348 GGTACCAGGCAGAGTGGGTAGGG + Intergenic
907405244 1:54250077-54250099 GGCAAGGGGCAGAGTAGGAGCGG - Intronic
908478871 1:64517438-64517460 GGGACAGGGGAGAGTTGGCAGGG + Intronic
908564278 1:65338615-65338637 GGAACAGGGTAGAGGGGGCAGGG - Intronic
909210689 1:72818678-72818700 GGCATGGGGCAGAGGGAGGAGGG + Intergenic
909541140 1:76792786-76792808 AGCAAGGGGCAGTGTGGGAAAGG - Intergenic
910230617 1:84983062-84983084 GGGATGGGGCAGGGTAGGCAGGG + Intronic
910408583 1:86915365-86915387 GTCACGGGGCAGAGGTTGCAAGG + Intronic
911242558 1:95481983-95482005 GGCAGGGGGCAGGGAGGGTAGGG - Intergenic
912877025 1:113370553-113370575 GGCCCAGGGCAGAGTGGGGAAGG + Intergenic
913061175 1:115209713-115209735 TGTATGTGGCAGAGTGGGCAGGG + Intergenic
913490359 1:119374151-119374173 AGCATGGGGAAGAGAGGGCAGGG - Intronic
915145817 1:153795247-153795269 GGAACAGGGAAGAGAGGGCAGGG - Intergenic
915267120 1:154726853-154726875 AGCCCGGGGGAGGGTGGGCAAGG + Intronic
915349092 1:155213414-155213436 AGCCCTGGGGAGAGTGGGCAGGG + Intronic
915352279 1:155234041-155234063 AGCCCTGGGGAGAGTGGGCAGGG + Intergenic
915442316 1:155952695-155952717 GCCCCTGGGCAGGGTGGGCAGGG + Exonic
917839443 1:178965664-178965686 TCAAGGGGGCAGAGTGGGCAGGG - Intergenic
918021997 1:180703173-180703195 GGCAGTGGGCAAGGTGGGCAAGG + Intronic
918381443 1:183959709-183959731 GGGGTGGGGCAGAGGGGGCATGG - Intronic
918407136 1:184222515-184222537 GTAAGGGGCCAGAGTGGGCATGG - Intergenic
919845644 1:201640487-201640509 GACAGGGGGAAAAGTGGGCAAGG - Intronic
919986947 1:202682047-202682069 GGCTCTGGGCAGAGTGGTCTGGG - Intronic
920336545 1:205248974-205248996 AGCACGGGGCAGAGCTGGGAGGG + Intronic
921060670 1:211581393-211581415 GGGGCGGGGCAGAGGGGGCAGGG + Intergenic
921758196 1:218883052-218883074 GGCAGGAGACAGAGTGTGCAAGG + Intergenic
922425186 1:225485656-225485678 AGCCCTGGGCAGTGTGGGCAAGG - Intergenic
923233572 1:232011084-232011106 GGCTCAGGGCTCAGTGGGCAGGG - Intronic
923537380 1:234863497-234863519 GGGACAGGGCACAGAGGGCAAGG - Intergenic
923865788 1:237938153-237938175 GGCAGGGGGAAGAGCAGGCACGG + Intergenic
924699668 1:246438729-246438751 GGCGGGGGGCGGAGTGGGGATGG + Intronic
924942967 1:248825213-248825235 GGCAGGGGGCAAAGGGGGCTTGG + Exonic
1062843857 10:689898-689920 GTCACGGGGCCGCGGGGGCAGGG + Intergenic
1063121816 10:3109884-3109906 CCCATGGGGCAGAGGGGGCAGGG + Intronic
1065214724 10:23438943-23438965 GGCGCGGGCCGGAGTGGGCGGGG + Intergenic
1065845381 10:29738745-29738767 GGCAGAGGGCAGACTGGGCAAGG - Intergenic
1067259910 10:44680409-44680431 TGCATGGGGCAGGGTTGGCAGGG - Intergenic
1067435600 10:46274124-46274146 CACTCGGGGCAGAGTGGGAAGGG + Intergenic
1067530263 10:47066063-47066085 GGCAAGGAGCAGGGTGGGGAAGG - Intergenic
1068401534 10:56534125-56534147 GTCAGGGGGCAGAAGGGGCAGGG - Intergenic
1069576468 10:69533514-69533536 GGGAAGGGGGAGAGTGGGCAAGG + Intergenic
1070148595 10:73792071-73792093 GGCACCTGGCCGAGAGGGCAGGG - Exonic
1070351521 10:75597384-75597406 GGGACTGGGTGGAGTGGGCAGGG - Intronic
1070532039 10:77345483-77345505 GTTTCTGGGCAGAGTGGGCAAGG - Intronic
1071878253 10:89865981-89866003 GGAAAGGGGCAGAGAGGGAATGG + Intergenic
1072727538 10:97823847-97823869 GCCACTGGGCAGAGAAGGCAGGG + Intergenic
1074335950 10:112575982-112576004 GGCAGGGGGCAGGGTGGGAATGG - Intronic
1074934119 10:118160486-118160508 AGCACGGGGCAGAGTAGTGATGG + Intergenic
1075517350 10:123119438-123119460 GTCACGGGGCAGGGAGGGAAGGG - Intergenic
1075615070 10:123884848-123884870 GGCATAAGGAAGAGTGGGCATGG + Intronic
1075700636 10:124467377-124467399 GGCAGGGTGGAGAGGGGGCAGGG + Intronic
1075780832 10:125016160-125016182 GGCACTGGGAAGGGTGGGCGGGG - Intronic
1076058245 10:127392774-127392796 GGCACGTGGCAGAGTGGGGTGGG - Intronic
1076070129 10:127482566-127482588 GGCACGGAGCAGGGTGGAGATGG - Intergenic
1076437301 10:130454912-130454934 GGCACAGGGAAGTGTGGACAGGG - Intergenic
1076629904 10:131846337-131846359 GGCACGGGGAGGAGTGGGTTAGG - Intergenic
1076695577 10:132245857-132245879 GGGACTGGGCTGAGGGGGCAGGG - Intronic
1076787849 10:132759893-132759915 TGCACCGGGCACAGTGAGCACGG - Intronic
1076790676 10:132775194-132775216 GGCAGGGAGGAGAGGGGGCAGGG + Intronic
1076811078 10:132886689-132886711 GGAAGGTGGCAGAGTGGGCTGGG - Intronic
1076822027 10:132944176-132944198 GGCACAGGGCAGGGTCGGAAAGG + Intergenic
1076892969 10:133293811-133293833 GGCACGTGGCTGTGGGGGCATGG - Intronic
1077047592 11:553282-553304 GGCAGGGGGCAGTGTAAGCAGGG + Intronic
1077134368 11:991258-991280 GGCAAGGTGCCGAGTAGGCAGGG - Intronic
1077185772 11:1234748-1234770 GGCAGCGGGCAGGGAGGGCAGGG + Intronic
1077185781 11:1234764-1234786 GGCAGGGGGCGGGGAGGGCAGGG + Intronic
1077308035 11:1876573-1876595 TGCAGGGGGCAGAGTCGGGACGG + Intronic
1077352120 11:2097844-2097866 AGCACGGGCCAGAGTGGGGAGGG - Intergenic
1077394669 11:2315163-2315185 GGGAGGGGGCAGGGTGGGCTGGG - Intronic
1077430071 11:2511921-2511943 GGCACAGGTCAGAGCGGGCATGG + Intronic
1077478715 11:2803101-2803123 GGTGAGGGGCAGAGTGAGCAAGG + Intronic
1078707802 11:13761994-13762016 GGCACAGAGCAGTGTGGACAGGG - Intergenic
1079242033 11:18728277-18728299 GGTAGGGGGCAGATGGGGCATGG - Exonic
1080785617 11:35472681-35472703 GTCATGGGGCAGAGTGGTCCAGG + Intronic
1081202610 11:40236053-40236075 GTCACGGCTCACAGTGGGCATGG + Intronic
1083147767 11:60771693-60771715 TGCACGGAGGAGTGTGGGCAGGG + Intronic
1083518052 11:63278926-63278948 GGCTCAGAGCAGTGTGGGCAGGG + Intronic
1083612691 11:64011689-64011711 GGTTCTGGGCAGAGTGGCCAGGG + Intronic
1083735184 11:64676120-64676142 GGCAGCGGGCAGAGAGGGCAGGG + Intronic
1084215094 11:67642742-67642764 GGCAGGGGTCAGCGCGGGCATGG + Exonic
1084268711 11:68017956-68017978 AGCAAGAAGCAGAGTGGGCAAGG - Intronic
1084355117 11:68633354-68633376 TTCACGGGGCAGAAGGGGCAGGG + Intergenic
1084544717 11:69809186-69809208 GGCACTTGGCAGGATGGGCAGGG - Intergenic
1084598323 11:70130441-70130463 GCCACGCAGCAGAGTGGGAATGG - Intronic
1084649458 11:70480214-70480236 GGCACGGGACAGAGAGTACAAGG - Intronic
1085033739 11:73287987-73288009 GGCACAGGGCTGAGAGGTCAAGG - Intronic
1085266475 11:75240766-75240788 GGCTCCGAGCCGAGTGGGCAGGG - Intergenic
1085512146 11:77093818-77093840 GGCCTCGGGCAGAGTGGGCAGGG + Intronic
1085644950 11:78216875-78216897 TACACTGGGCAGAGTTGGCAGGG - Exonic
1087153555 11:94879930-94879952 GGCAGGGGTCAGACTGTGCAGGG - Intergenic
1087315375 11:96596306-96596328 AGAATGGGGCAGAGTGGGGATGG + Intergenic
1089218738 11:116852973-116852995 TGGAGGGTGCAGAGTGGGCAAGG + Intronic
1089300001 11:117492793-117492815 GGCTGGGGGCGGAGTGGGGAGGG + Intronic
1089310559 11:117555646-117555668 TGCACGGGGCAGGGAGAGCAGGG + Intronic
1089581362 11:119483619-119483641 GGCACTGGGCAGAGAGGCCCAGG + Intergenic
1089624423 11:119742325-119742347 GGCCCGGGGGTGGGTGGGCAGGG + Intergenic
1090428889 11:126629573-126629595 GGCACAGGGCAGGGTGGACATGG - Intronic
1090442699 11:126737341-126737363 GGCACAAGGCACAGTGGGCAGGG + Intronic
1090918160 11:131185434-131185456 GGCACGGGGCACAGTGATGAAGG + Intergenic
1091396670 12:157470-157492 GGCCCGGGGGAGGGTGGGCGGGG + Intronic
1091768535 12:3137285-3137307 GGCCCGGGGAAACGTGGGCAGGG - Intronic
1094555709 12:31497836-31497858 GGGAGGGGGCAGGGGGGGCAAGG + Intronic
1096462360 12:51829053-51829075 GGCTGGGGGCAGGGTAGGCAAGG + Intergenic
1096985020 12:55750518-55750540 TAAACGGGGCACAGTGGGCAGGG - Exonic
1097193270 12:57230386-57230408 GGGAAGAGGCAGAGTTGGCAAGG - Intronic
1098029015 12:66235314-66235336 GGCGCGGGGCAGCCTGGGCGCGG + Intronic
1100662527 12:96715469-96715491 GGCAGGGGGAAGAGAGGGAAAGG + Intronic
1101083177 12:101209476-101209498 GGTAAGGGGCAGGGTGGGCTGGG - Exonic
1101439744 12:104694665-104694687 GGAACGAGGCAGAGGGGACATGG + Intronic
1101937495 12:109070012-109070034 GGCAGGGAGCAGATTGTGCAGGG + Intronic
1102540628 12:113616638-113616660 GGCACAGGGCAGCGAGGGGATGG + Intergenic
1102544605 12:113645654-113645676 GGCCAGGGGCAGAGAGGGCTGGG - Intergenic
1102735228 12:115153393-115153415 GGCACAGGGCAGAATGGAGAAGG - Intergenic
1103058011 12:117836698-117836720 GACACGGGCCACAGTTGGCAAGG - Intronic
1103146488 12:118599544-118599566 GGCAGAGGCCAGAGTGTGCAGGG - Intergenic
1103238964 12:119397894-119397916 GGAAGGGGGCAGGGTGGGGAAGG + Intronic
1103547422 12:121712326-121712348 GGCGCAGCGCAGAGAGGGCACGG - Intergenic
1103685474 12:122729045-122729067 GGCAGGGGACAGAATGTGCATGG - Exonic
1104411310 12:128560345-128560367 GGTAAGGTCCAGAGTGGGCAGGG - Intronic
1104536763 12:129624874-129624896 GGCACAGGGCAGAGTGGAGAAGG + Intronic
1104748015 12:131221927-131221949 GGCAGAGGGCAGAGGGGTCAGGG + Intergenic
1104836282 12:131793905-131793927 GGCTCGGGGGAGAGTGGGCACGG + Intronic
1105688076 13:22806024-22806046 GGAACGAGGCAGAGTTTGCAGGG + Intergenic
1105920509 13:24958946-24958968 AGCCGGGGGCAGAGTGGGGAGGG + Intergenic
1107396515 13:40023554-40023576 GGCATGGGGTAGGGTGGGAATGG + Intergenic
1107985681 13:45774280-45774302 GGTTAGGGGCAGAGTTGGCAAGG + Intergenic
1108594457 13:51937750-51937772 GGCCGAGGGCAGAGGGGGCAAGG - Intronic
1112285930 13:98104473-98104495 GGCAGGAGGCAGAGGGAGCAGGG + Intergenic
1112331890 13:98483147-98483169 GGCACGGGGCAGCCTGGGCAGGG + Intronic
1113416938 13:110136162-110136184 GGCTCAGGGCAGTGTGGGGAGGG - Intergenic
1117396641 14:55317150-55317172 GGGAAGGGGTAGAGTGGGCTCGG + Intronic
1117499929 14:56341502-56341524 GGGACTGGGCAGAGTGGGCAGGG + Intergenic
1119053076 14:71389853-71389875 GGCTCGGAGGAGAGTGGGAAAGG + Intronic
1119103924 14:71906402-71906424 GGAACGGGGCAGACTGGGTGAGG + Intergenic
1119511558 14:75215545-75215567 GGGCAGGGGCAGGGTGGGCAGGG + Intergenic
1120703699 14:87725802-87725824 GACTTGGGGGAGAGTGGGCAGGG - Intergenic
1121042195 14:90758466-90758488 GGGGCGGGGCAGGGGGGGCACGG + Intronic
1121096183 14:91219669-91219691 GCCAAGGGCCAGAGTGGGCAGGG - Intronic
1121304754 14:92899032-92899054 CGCACGGGGCAGAGGGGGGAGGG + Intergenic
1121465140 14:94111031-94111053 GGCTTGGGGTAAAGTGGGCAAGG + Intronic
1121561993 14:94882770-94882792 GGCTAGGGGCTGAGTGGACAGGG - Intergenic
1121607662 14:95253146-95253168 GTCAGGGGCCACAGTGGGCATGG - Intronic
1121648833 14:95540525-95540547 GGCACGGGGCAGAGTGGGCAAGG - Intronic
1121698536 14:95933118-95933140 AGCACAGGGCAGAGTGTGAAGGG - Intergenic
1122024935 14:98868945-98868967 GGCATGGGCCAGAATGGGCCTGG - Intergenic
1122302315 14:100738290-100738312 GGCCCCGGGCAGGGTGGGCAGGG + Intergenic
1123562754 15:21513237-21513259 GGCAGGGGGCAGGGTGGGTTGGG - Intergenic
1123598998 15:21950520-21950542 GGCAGGGGGCAGGGTGGGTTGGG - Intergenic
1124240340 15:28023114-28023136 GGAACCGGGCAGGGTGGGCCAGG - Intronic
1124803061 15:32853819-32853841 GGCCAGGCCCAGAGTGGGCAGGG + Intronic
1124983500 15:34584139-34584161 TGCACCGGGCAGAGCGAGCAGGG - Intronic
1125343977 15:38700416-38700438 GGCAGGAGGGAGAGAGGGCAGGG + Intergenic
1125519412 15:40339777-40339799 GGCCAGGGGTAGGGTGGGCATGG - Intronic
1125769348 15:42154538-42154560 GGGAAGGAGCAGAGTGGGGAGGG + Intronic
1127983384 15:64050437-64050459 GGCACAGGGCAGAGTGGGCATGG - Intronic
1128361041 15:66962001-66962023 GGCAGGAGGAGGAGTGGGCAAGG - Intergenic
1128514519 15:68334040-68334062 GGCAGGGAGCAGAGTGGAGAAGG - Intronic
1129263856 15:74383554-74383576 TGCACAGGGCACAGTGGGCTTGG - Intergenic
1129384694 15:75189498-75189520 GGCTCAATGCAGAGTGGGCAGGG - Intergenic
1129667670 15:77588478-77588500 GGGACGGGGAGGAGTGGGGATGG + Intergenic
1129687708 15:77696001-77696023 GGCACAGGGCGGGCTGGGCAAGG + Intronic
1130770595 15:86919907-86919929 GGCCCATGGCAGAGTGGGCCAGG - Intronic
1131259294 15:90880287-90880309 GGCGCTGGGCAGGGCGGGCAGGG - Intronic
1131551650 15:93362402-93362424 TGAACGGGGCAGAGAGGGCTAGG + Intergenic
1132015544 15:98313214-98313236 GGCAGGGGGTTGAGTGGGGAAGG - Intergenic
1132288727 15:100684801-100684823 GGCGCGGGTCACAGTGGGCCTGG + Intergenic
1132392650 15:101450302-101450324 GACAGAGGGCAGTGTGGGCAGGG - Intronic
1202971105 15_KI270727v1_random:240370-240392 GGCAGGGGGCAGGGTGGGTTGGG - Intergenic
1132484141 16:181452-181474 TGCTCGGCGCAGAGTGGGGAGGG - Intergenic
1132639583 16:971467-971489 AGCAAGGGACAGAGTAGGCAGGG + Intronic
1132852882 16:2032844-2032866 GGCAGGGGGCAGAGGGCTCAGGG - Intronic
1132874982 16:2133127-2133149 GGGTCGGGGCAGGGAGGGCAGGG + Intronic
1133055116 16:3141912-3141934 AGGACAGGGCAGAGTGGTCATGG - Exonic
1133301117 16:4783589-4783611 GGCAGAGGGCAGAGTGGGCAGGG - Intronic
1134452017 16:14369421-14369443 GGCACAGGCCAGAGTGAGGAAGG + Intergenic
1134520008 16:14914263-14914285 GGGTCGGGGCAGGGAGGGCAGGG - Intronic
1134553925 16:15151974-15151996 GGGTCGGGGCAGGGAGGGCAGGG + Intergenic
1134707681 16:16312917-16312939 GGGTCGGGGCAGGGAGGGCAGGG - Intergenic
1134959862 16:18399208-18399230 GGGTCGGGGCAGGGAGGGCAGGG + Intergenic
1135540333 16:23324941-23324963 GGCATGGGGCCTGGTGGGCAGGG + Intronic
1135738959 16:24957069-24957091 AGCATGGAGCAGAGTGGGCCAGG + Intronic
1136378517 16:29879593-29879615 GGCAGGCTGGAGAGTGGGCAGGG - Intronic
1136540762 16:30926586-30926608 GGGAGGTGGCAGAGTGGGGAGGG - Intronic
1137761596 16:50945270-50945292 AGCACTGGGCAGAATGTGCATGG + Intergenic
1138179819 16:54933493-54933515 GGCCCGGGACACGGTGGGCATGG - Exonic
1139490599 16:67284022-67284044 GGGACGGGGCAGAGTGGAGCTGG + Intronic
1139594280 16:67948996-67949018 GCCACGGAGCAGGGTGGGCGAGG + Intronic
1140985738 16:80156648-80156670 GGCAAGACTCAGAGTGGGCAGGG + Intergenic
1141002108 16:80317830-80317852 GGCAGGCGCCAGTGTGGGCAAGG + Intergenic
1141087802 16:81109105-81109127 GGCACGGGGCGGGGTGGACAGGG + Intergenic
1142126104 16:88411447-88411469 GGCAGGGGTGCGAGTGGGCAGGG + Intergenic
1142208000 16:88793095-88793117 GGCAGGGGCAGGAGTGGGCAGGG - Intergenic
1142726926 17:1822309-1822331 GGAATGGGGAAGAGTGGACAGGG + Intronic
1142862497 17:2771324-2771346 TGCTGGGGGAAGAGTGGGCAGGG - Intergenic
1146268417 17:31468346-31468368 GGCCTGGGGCAGAGTGGAGAGGG + Intronic
1146465132 17:33080188-33080210 GGGCCAAGGCAGAGTGGGCAGGG + Intronic
1147155741 17:38543774-38543796 GGCATGCAGCAGAGTGGGCCTGG + Intronic
1147240043 17:39084821-39084843 GGCAGGGGGCGCAGTAGGCACGG + Intronic
1147635153 17:41959480-41959502 GGCACTGGGCAAAGAGAGCAGGG + Intronic
1147951541 17:44110545-44110567 GGCTCTGGGCAGGGAGGGCAGGG + Intronic
1147976247 17:44249758-44249780 GGCTGGGAGCAGAGTGGGGAAGG + Exonic
1148171566 17:45525208-45525230 GGCACGGGGATGACAGGGCATGG - Intergenic
1148277806 17:46321198-46321220 GGCACGGGGATGACAGGGCATGG + Intronic
1148300013 17:46539053-46539075 GGCACGGGGATGACAGGGCATGG + Intronic
1148364457 17:47043341-47043363 GGCACGGGGATGACAGGGCATGG + Intronic
1148733312 17:49851012-49851034 GGCACGGGGCAGAAAGGAGAGGG + Intergenic
1148850788 17:50554119-50554141 GGGAAGGGGCAGGATGGGCAGGG + Intronic
1148859390 17:50596227-50596249 GGCACAGGCCAGAGGGGGCTGGG - Intronic
1148933383 17:51145298-51145320 GGCACTGTGCAGACTGGGCTGGG + Intergenic
1149569989 17:57665594-57665616 GGCAGGGGGCAGGGTGGGGTGGG - Intronic
1149684539 17:58527820-58527842 GGCTCTGGGCAGAGGGGGTAAGG - Intronic
1150402491 17:64870244-64870266 GGCACGGGGATGACAGGGCATGG - Intronic
1150963137 17:69936791-69936813 GGCATTGGGAAGAGAGGGCAAGG + Intergenic
1151678157 17:75610460-75610482 GGCCCTGGGGAGAGTAGGCAGGG - Intergenic
1151756036 17:76075831-76075853 GGCGAGAGGCAGAGTGGGCTGGG - Intronic
1151761260 17:76104400-76104422 GGCCAGAGGCAGGGTGGGCAGGG - Intronic
1152076714 17:78164504-78164526 GGCAGGGGCCAGGGTGGGCATGG - Intronic
1152097217 17:78279097-78279119 GGGACATGGCAGAGTGGGCAGGG + Intergenic
1152260401 17:79263646-79263668 GGCTCGGGGCAGAGGGGGTGTGG - Intronic
1152334641 17:79693477-79693499 GGCACAGGGGAGCCTGGGCAGGG + Intergenic
1152374681 17:79913080-79913102 GCCAAGGGGCAGGGTGGGCGTGG - Intergenic
1152603277 17:81276203-81276225 GGCACCTGTCACAGTGGGCAGGG + Intronic
1152629563 17:81404443-81404465 GGCCTGGGCCAGAGTGGGGAGGG + Intronic
1152754602 17:82081962-82081984 GGGAGAGGGCAGGGTGGGCAGGG + Intronic
1152947278 17:83205059-83205081 GGACGGGGGCAGAGTCGGCAGGG + Intergenic
1154203333 18:12316035-12316057 GGCCTGGGGCAGACTGGGCCGGG - Intronic
1155168229 18:23248071-23248093 GACCCGGGCCAGAGTGGGCCTGG + Intronic
1155546256 18:26919025-26919047 GGCAAGAGGGAGAGTGTGCAGGG + Intronic
1155833525 18:30548303-30548325 AGAAGGTGGCAGAGTGGGCAAGG - Intergenic
1156994234 18:43447284-43447306 GGCAAGGGGCAGTGGGGCCAGGG - Intergenic
1157274717 18:46302442-46302464 GGGATGGGGCAGAGTGGGGCGGG - Intergenic
1158051474 18:53225969-53225991 GGCATGGGGCAGAGTGGTGATGG + Intronic
1159955414 18:74515391-74515413 GGCACGGGGAGGAGCGGGCCTGG + Intronic
1159965560 18:74592222-74592244 GGCACTTGGCTGAGTGGGAAAGG - Intergenic
1160875663 19:1295275-1295297 GGCACGGGACAGGGTGAGCGGGG - Intronic
1160875678 19:1295326-1295348 GGCACGGGTCAGTGTGCGCGGGG - Intronic
1160975621 19:1790891-1790913 TTCACCGGGCAGAGTGGGCGTGG - Intronic
1161125051 19:2551094-2551116 GGCACGGAGCTGCCTGGGCAAGG - Intronic
1161170582 19:2810577-2810599 AGCTCTGGGCAGAGTGGGCCGGG + Intronic
1161328065 19:3672897-3672919 GGGCGGGGGGAGAGTGGGCAGGG + Intronic
1161331976 19:3692800-3692822 GGGACGGGGCAGGGTGTGCAGGG - Intronic
1161332902 19:3696759-3696781 GGCCCGGGGCAGGCTGTGCAGGG + Intronic
1161630815 19:5354545-5354567 GGAACAGGGCAGGGTGTGCAGGG + Intergenic
1161800986 19:6416689-6416711 GGCCCAGGGAAGAGGGGGCAAGG + Intronic
1161801237 19:6417709-6417731 GGCCAGGGGCAGGGTGGGCCAGG + Intronic
1161925642 19:7296887-7296909 GGCCCAGAGGAGAGTGGGCAAGG + Intergenic
1162705047 19:12549440-12549462 CGCTTGGGGCAGAGTGAGCAGGG - Intronic
1162720006 19:12656695-12656717 GGCGGGGGTCAGAGAGGGCATGG + Intronic
1163429150 19:17256567-17256589 TGCACGGGGCACAGTGGGCATGG + Exonic
1163618378 19:18342797-18342819 GGCCAGGGGCAGACTGGGAAGGG + Intronic
1164812860 19:31171821-31171843 GGCCTGGGGCAGAATGGACAGGG - Intergenic
1165223774 19:34339444-34339466 GGCACAGGGCATAGCTGGCAAGG - Intronic
1165346767 19:35253526-35253548 GGCATGGGGCAGAGCGGGGAAGG + Intronic
1165385399 19:35507556-35507578 GGCAGGGGGACGAGAGGGCAAGG + Intronic
1165392353 19:35545831-35545853 GGCGCGGGGCGGAGAGGGCGCGG + Intronic
1165856831 19:38883970-38883992 GGCAGGGGCCAGGCTGGGCATGG + Intronic
1165865205 19:38932702-38932724 GGCTGGGGGCACAGTGGGCTGGG + Exonic
1165940933 19:39414357-39414379 AGCGCTGGGCAGAGTGGTCAGGG + Intronic
1166338375 19:42122466-42122488 GGCAGGGGTCACCGTGGGCAGGG - Intronic
1167350908 19:48974178-48974200 GGCAGGGGACAGCGTGGTCATGG - Intronic
1167470568 19:49673516-49673538 GGCACAGGGATGAGGGGGCAGGG - Intronic
1167561763 19:50230430-50230452 AGAAGGGGGCAGCGTGGGCAGGG + Intronic
1167565320 19:50252433-50252455 GGCAGGGGGCATAGAGGGGAAGG + Intronic
1167783135 19:51613516-51613538 GGCACAGGGCAGACAGGGCTGGG + Intronic
1168269979 19:55244513-55244535 AGCACAGGCCAGGGTGGGCAGGG + Intronic
1168510150 19:56967346-56967368 GGCAGGGGGAAGAGAGGGAAGGG - Intergenic
1168630883 19:57955202-57955224 GGCACAGGACAGAGCGGCCAGGG - Intergenic
925098690 2:1228127-1228149 GTCACAGGGCTGAGTGTGCACGG - Intronic
925169786 2:1743762-1743784 GGAACGGGGCGGAGGGGGCTGGG + Intronic
925347073 2:3178904-3178926 GGCAGGGAGCTGGGTGGGCACGG - Intergenic
925986229 2:9217354-9217376 CCCACGGAGCAGAGTGGCCAGGG + Intronic
926101892 2:10123068-10123090 GGCGTGGGGCAGAGGGGCCAGGG + Intronic
926308536 2:11657846-11657868 GCCTCGTGGCAGAGTGTGCATGG + Intergenic
927442682 2:23130363-23130385 GGCATGGGGCAAAGTGTGCTCGG + Intergenic
927488362 2:23504558-23504580 GGGAGGGGGCACAGGGGGCAGGG + Intronic
927713559 2:25340131-25340153 GGCAGGCGGGAGGGTGGGCAGGG - Intronic
927928491 2:27028919-27028941 AGAAAGGGTCAGAGTGGGCAGGG + Intergenic
928771188 2:34703200-34703222 TGCAGGGGGCAGAGTGAGGAAGG + Intergenic
929127598 2:38535617-38535639 GGCAGGGGGCAGAGTGTTCACGG - Intergenic
929157948 2:38804628-38804650 TGCACGGGGACGAGTAGGCAGGG - Intronic
929883786 2:45860715-45860737 AGCACTGGCCAAAGTGGGCAGGG - Intronic
930747593 2:54900775-54900797 GGCACAGAGCAGGGTGGACAAGG + Intronic
931272822 2:60717744-60717766 GGCACAGGGCATGGTGGGTAAGG - Intergenic
932021731 2:68094465-68094487 AGCATGTGGCAGGGTGGGCATGG - Intronic
932212673 2:69945435-69945457 TGCATGGAACAGAGTGGGCAGGG - Intergenic
932565215 2:72901866-72901888 GGCAGGGGGCAGAGTGAGTGTGG - Intergenic
932608034 2:73177308-73177330 GGAACGGGGGAGAGGGGGAAGGG - Intergenic
933767570 2:85720503-85720525 GGCAGGGGCTAGATTGGGCAGGG + Intergenic
933811781 2:86037184-86037206 GGCACTGGGCAGAGTGGCAGGGG - Intronic
934819329 2:97358331-97358353 GGTATGGGGCAGAGGCGGCAGGG + Intergenic
935022704 2:99246971-99246993 AGATCGGAGCAGAGTGGGCATGG - Intronic
937123098 2:119454231-119454253 GGCAGGCGGCAGAGTGGGGCTGG + Intronic
937619764 2:123972036-123972058 GGCATGGAGCTGATTGGGCAAGG - Intergenic
937982144 2:127622111-127622133 GGCAGGGGTGAGAGCGGGCAGGG + Intronic
937988308 2:127648553-127648575 GGCACGGGGCAGAGAGGGCATGG - Intronic
938099242 2:128486840-128486862 GCCCCGTGGCAGAGTAGGCATGG - Intergenic
941486058 2:166084277-166084299 GGCACAGTCCAGAGTGGGAAGGG - Intronic
942495056 2:176531493-176531515 GGATCAGGGCAGAGAGGGCATGG - Intergenic
944857040 2:203777903-203777925 GGCAGGGGGCAGGGCGGGGAGGG + Intergenic
945840088 2:214877189-214877211 GGCTCAGAGCAGAGTGGGGAAGG + Intergenic
946100402 2:217315623-217315645 GGTAGGGGGCACAGTGGGCCAGG - Intronic
946179541 2:217941372-217941394 GGCAAGGGGCAGAGTGGGCCAGG + Intronic
946396391 2:219445690-219445712 GGCCAGGGGCAGATGGGGCAAGG + Intronic
946641555 2:221788956-221788978 GGCACAGAGCAGAGTGGAGAGGG + Intergenic
946961851 2:224993712-224993734 GGTAGGGGACAGAGTGGGCTTGG - Intronic
947632820 2:231665094-231665116 TGCACGGGGCTGGGTGGGGAGGG - Intergenic
948048499 2:234961828-234961850 GGAACTGGGCAAAGTTGGCATGG - Intronic
948677561 2:239607721-239607743 GGCACGGGGCAGCGAGGGGTAGG + Intergenic
949058968 2:241945513-241945535 GGCTTGGGGCAGAGGGTGCAGGG + Intergenic
1168805302 20:669142-669164 GGCACGGGGTGGTGGGGGCATGG + Intronic
1169217535 20:3802176-3802198 GGCAGGTGGCAGCCTGGGCATGG + Intronic
1171071680 20:22075033-22075055 GGCAGGGGGCAGATTAGGAAGGG - Intergenic
1172010634 20:31844067-31844089 GGCAAGGGAGAGACTGGGCAGGG - Intergenic
1172101659 20:32487409-32487431 GGCTCTGGGCTGAGTGGTCAGGG + Intronic
1172479787 20:35264229-35264251 GGGACGGGGAAGAGTGTGGAAGG - Intronic
1172481105 20:35271844-35271866 GGGCCGGGCCAGGGTGGGCATGG + Intronic
1172601841 20:36189421-36189443 GGCATGGGGCAGTGTGGCAAGGG - Intronic
1172621411 20:36320420-36320442 GGCAAGGGTCAGTGTGGGCCTGG - Intronic
1172845458 20:37927623-37927645 GGCAAGGCTCAGAGAGGGCAGGG - Intronic
1172941680 20:38658684-38658706 GGCAGGGGGCAGAGTGGGCAGGG + Intergenic
1173583022 20:44160478-44160500 GGCAAGGGCGGGAGTGGGCAAGG + Intronic
1173725982 20:45298139-45298161 GGCATGGGACACAGTGGGCTGGG - Intronic
1173855912 20:46250858-46250880 GGCATGGGGCGGAGTGGGAGTGG + Intronic
1174172688 20:48627259-48627281 GGCTCAGGGCTGAGAGGGCATGG + Intronic
1175213300 20:57375366-57375388 GGCAAAGGGCAGAGTGGGGTGGG - Intronic
1175336067 20:58197127-58197149 GTGACGGGGCAGAGTGGGAGAGG - Intergenic
1175549176 20:59805615-59805637 GGCTGGGGGGACAGTGGGCAGGG + Intronic
1175835205 20:61989307-61989329 GGGAAGCTGCAGAGTGGGCAGGG + Intronic
1176109881 20:63406366-63406388 GGCCCTGAGCAGAGTGGACAGGG + Exonic
1176119379 20:63447104-63447126 GGCAGGGGCCAGAGTGGAGAGGG - Intronic
1176195904 20:63836240-63836262 GGCAGGGGAGAGCGTGGGCAGGG + Intergenic
1176247043 20:64102355-64102377 GACACGGGGCGGGGTGGGCGCGG - Intergenic
1176306625 21:5126926-5126948 GGCACTAGGCAGAGTGAGCTGGG - Intronic
1177202716 21:17975773-17975795 GGGATGTTGCAGAGTGGGCAGGG - Intronic
1179472402 21:41620481-41620503 GACACCGGGCAGGGTGGGGAGGG - Intergenic
1179605800 21:42514350-42514372 GGCCCGGGCCGGGGTGGGCAGGG - Exonic
1179792368 21:43762917-43762939 GGCACGGGGCGGCCGGGGCAGGG + Intergenic
1179850432 21:44135104-44135126 GGCACTAGGCAGAGTGAGCTGGG + Intronic
1180593701 22:16960626-16960648 CACACTGGGCAGAGTGTGCAGGG - Intergenic
1180755975 22:18161492-18161514 GGCAGGGTGCAGAGGGGCCAAGG + Intronic
1180765789 22:18345280-18345302 GGGGCTGTGCAGAGTGGGCAGGG - Intergenic
1180780521 22:18517098-18517120 GGGGCTGTGCAGAGTGGGCAGGG + Intronic
1180813240 22:18774419-18774441 GGGGCTGTGCAGAGTGGGCAGGG + Intergenic
1181075793 22:20375911-20375933 GGCAGGGTGCAGAGGGGCCAAGG - Intronic
1181199416 22:21208735-21208757 GGGGCTGTGCAGAGTGGGCAGGG + Intronic
1181922957 22:26334792-26334814 GAGAAGGGCCAGAGTGGGCAGGG + Intronic
1182149887 22:28020466-28020488 GCCAAGGGGCAGAGGGGTCAGGG + Intronic
1183311504 22:37112308-37112330 GGGACGAGGGACAGTGGGCAGGG - Intergenic
1183345029 22:37302888-37302910 GGCAGAGAACAGAGTGGGCAGGG + Intronic
1183378148 22:37476997-37477019 GCCAAGGGGCAGAGTGAGCCTGG + Intronic
1183741981 22:39673923-39673945 GGCCTGGGGCTGAGTGGGCAGGG + Intronic
1183959374 22:41402116-41402138 GCCACGGGGCAGTGTGTGAAGGG - Intergenic
1183972825 22:41491115-41491137 GGCAAAGGGCAGACTGGGAATGG + Intronic
1184038954 22:41932333-41932355 GGGAGAGGGCAGAGTGGCCACGG + Intergenic
1184109042 22:42384485-42384507 GGCATGGAGCAGAGAGGGCTTGG - Exonic
1184340294 22:43882134-43882156 GGCATGGGGTAGGGAGGGCAGGG - Intronic
1184805612 22:46793209-46793231 GGCACTGGCCAGAGTGAGCTGGG + Intronic
1184821069 22:46909677-46909699 AGCAGGGGGCAGAGGGGACAGGG - Intronic
1184924190 22:47625916-47625938 GGCAGAGGGCAGGGTGGCCAGGG - Intergenic
1185164743 22:49254641-49254663 GGCAGGAGGCAGTGAGGGCAGGG + Intergenic
1185211579 22:49573541-49573563 AGCAAGGCCCAGAGTGGGCAGGG + Intronic
1185258314 22:49848718-49848740 GGCGCGGCGCAGGGCGGGCAGGG - Intergenic
1185313683 22:50170045-50170067 GGCCCGCGGGAGGGTGGGCAGGG - Intergenic
1185371939 22:50464967-50464989 GGCAGGGGGCTGGGAGGGCAGGG + Intronic
1185379662 22:50502626-50502648 CGGAAGGGCCAGAGTGGGCAAGG - Intergenic
1185419515 22:50727721-50727743 GGCAGAGGGCGGAGTGGGGAGGG + Intergenic
1203227411 22_KI270731v1_random:86171-86193 GGGGCTGTGCAGAGTGGGCAGGG - Intergenic
1203263342 22_KI270734v1_random:101-123 GGGGCTGTGCAGAGTGGGCAGGG + Intergenic
949318188 3:2780350-2780372 GGAACAGGGCTGAGAGGGCAAGG - Intronic
950118650 3:10467540-10467562 GGCACGTGGAAAAGTGGCCACGG + Intronic
951638260 3:24804459-24804481 GGCATGGGGTAGGGTGGGAAGGG + Intergenic
952505594 3:34004403-34004425 GGCAGGGGGCAGAATGCACATGG + Intergenic
953390466 3:42530957-42530979 GGCTGGGGACAGAGGGGGCAAGG + Intronic
953827005 3:46262048-46262070 GACATGGGGCAGAGTGGGAAGGG - Intronic
953835473 3:46339268-46339290 GGCACAGGGCAGCGGGGCCATGG + Intergenic
954131025 3:48561026-48561048 GGCACGGGACAGCGTGGGGAGGG - Intronic
954416953 3:50397984-50398006 GGGGTGGGGCAGGGTGGGCACGG - Intronic
954700566 3:52448765-52448787 GGTGCTGGGGAGAGTGGGCAGGG - Intergenic
954952682 3:54489119-54489141 GGCAGAGGCCAGAGTGAGCAGGG + Intronic
955066380 3:55536814-55536836 GGCACTGGGCCGAGGGGGCTGGG - Intronic
955084915 3:55693400-55693422 GGCTCAGGGGAGAGTGAGCAAGG + Intronic
955215675 3:56983359-56983381 GGCAGGGGTCACAGTGGGGAGGG - Intronic
955721528 3:61886546-61886568 GGCAAGGGGCAGGGCGGGGAAGG - Intronic
955767958 3:62364812-62364834 TGCACGGAGCAGAGATGGCAAGG - Intergenic
955829595 3:62986927-62986949 GGGCTGGGGCAGAGTGGGCTAGG - Intergenic
956654615 3:71536949-71536971 GGCAGGAGGCAGAGTCAGCAGGG - Intronic
957589650 3:82179494-82179516 GCCACGAGGCACAGTGGGCATGG + Intergenic
957730447 3:84126404-84126426 GGCACGGAGCGGAGTGAGCATGG - Intergenic
959566095 3:107834547-107834569 GGCAGGGGGCGGAGTGAGGAGGG + Intergenic
960164053 3:114381806-114381828 GGCAGGAGGCAGAGATGGCATGG + Intronic
960736271 3:120784556-120784578 GGGACCGGGGAGAGTAGGCAGGG + Intergenic
960937416 3:122912416-122912438 GGCTCAGGGCAGAGTGGTCTGGG - Intronic
961037216 3:123650935-123650957 GTCACAGGGCAAAGTGTGCATGG + Intronic
961673175 3:128549440-128549462 GGCTGGGGGCAGGGTGGGCCTGG + Intergenic
962246842 3:133802517-133802539 GGGATGGGGCAGTGTGGGGATGG - Intronic
962348650 3:134640963-134640985 GACACAGGGCAGAGTTGGCAGGG - Intronic
962396466 3:135018970-135018992 GGCATGAGGCAGAGAGGACAGGG + Intronic
963192465 3:142487987-142488009 GGCACTGAGCAGAGTGGAAAAGG - Intronic
963814304 3:149812845-149812867 GGCGCGGGACCGAGCGGGCAGGG - Exonic
964259002 3:154812077-154812099 GACACTGGCCAGAGTGGCCAAGG - Intergenic
966107101 3:176349251-176349273 GCCAGGGTGCAGAGGGGGCAAGG - Intergenic
966878161 3:184335299-184335321 GGCAGGGGGAAGGGGGGGCACGG + Exonic
966881222 3:184352389-184352411 GGCACCGGGCAGGGAGGGCAGGG - Intronic
968481412 4:834713-834735 GGCAGGGGCCAGAGACGGCAGGG + Intergenic
968584827 4:1411444-1411466 GGCAGAGGCCAGAGAGGGCAGGG - Intergenic
968646061 4:1741183-1741205 GGCAGGAGGCAGAGTGAGCAGGG + Intronic
968647953 4:1749334-1749356 GGGAGGGGGCACAGTGGGGAGGG - Intergenic
968648532 4:1751443-1751465 GGCCCGGGACAGAGAGGGCATGG - Intergenic
968866044 4:3212585-3212607 GGCCCGGGCCAGAGTGGGCAGGG - Exonic
969108406 4:4825698-4825720 AGCATGGGGCACACTGGGCATGG + Intergenic
969391171 4:6892243-6892265 AGCGTGGGGCAGGGTGGGCAAGG + Intergenic
969459675 4:7322302-7322324 GGCCCAGGACAGAGGGGGCATGG - Intronic
969602804 4:8187024-8187046 GGCAGGTGTCAGAGAGGGCAAGG - Intronic
970647988 4:18145325-18145347 GGCAGGAAGGAGAGTGGGCAAGG - Intergenic
972324888 4:38006044-38006066 AGCAGGGAGCAGAGAGGGCATGG + Intronic
972340665 4:38149769-38149791 AGTACAGGGCAGAGGGGGCAGGG - Intergenic
973916290 4:55637335-55637357 GGCGCGGGGGAGAGGGGGCGGGG - Intergenic
975523742 4:75327350-75327372 AGGATGGGGAAGAGTGGGCAGGG - Intergenic
975705798 4:77110925-77110947 GGCACAGAGCAGAGTAGACAGGG - Intergenic
976107875 4:81639392-81639414 GTCACTGGGCAGGGTGGGGAGGG - Intronic
982740782 4:159054811-159054833 GGCAAGGGGCAGGGTGGGAGGGG - Intergenic
985053703 4:186017892-186017914 GGCAGGAGGCAGAGTGAGCAGGG + Intergenic
985487337 5:158801-158823 AGGATGGGGCAGAGTGGGGAGGG - Intronic
985589294 5:756448-756470 GGCACAGGGCTGTGTGTGCAGGG - Intronic
986321262 5:6633926-6633948 GGCACCGGGCAGTGAGGGGAGGG - Intronic
987574090 5:19703717-19703739 GGCGGGGGGCAGGGGGGGCAGGG - Intronic
988850901 5:35179859-35179881 GGGACGGGGCAGAGAGGGGGTGG + Intronic
989143815 5:38228520-38228542 GTCACTGGGCAGAGTGGGCCAGG - Intergenic
989160038 5:38381794-38381816 GGCACAGGGCAGGGTGGAGAAGG + Intronic
989455363 5:41637576-41637598 GGCCTGAGGCTGAGTGGGCAGGG - Intergenic
990148396 5:52788352-52788374 GGCGCGGGGCCGAGGGGCCATGG - Exonic
990279330 5:54232599-54232621 GAAACAGGGCAGAGTGGGAAGGG + Intronic
991962218 5:72056511-72056533 GGCAGGGAGCAGAGTGGGACAGG + Intergenic
992377196 5:76199627-76199649 CGCCCATGGCAGAGTGGGCATGG + Intronic
997013209 5:129903948-129903970 GGGGCGGGGCAGAGTGGTAAGGG + Intergenic
997592891 5:135086470-135086492 GGCACGGAGTAGTGTGGTCAGGG + Intronic
997975959 5:138441334-138441356 GGCACGGGGCTGAGGGGCCAGGG - Intronic
998162249 5:139820195-139820217 GGCTTGGGGCAGAGTGTCCAGGG + Intronic
999071129 5:148745172-148745194 TGTATGGGGCAGAGTGGGAAGGG + Intergenic
1001317788 5:170656656-170656678 GGCAGAGAGCAGAGTGGACATGG + Intronic
1001925451 5:175632964-175632986 CTCAAGGAGCAGAGTGGGCAAGG - Intergenic
1002041803 5:176520244-176520266 GGCACTGGAAAGAGAGGGCAGGG + Intergenic
1002102060 5:176862574-176862596 GCCAGGGGCCAGACTGGGCAGGG - Intronic
1002431759 5:179208146-179208168 AGCATCGGGCAGTGTGGGCAAGG - Intronic
1002450666 5:179316613-179316635 GGCCCAGGGCAGAGCAGGCACGG + Intronic
1002568511 5:180127457-180127479 GGGGCGTGGCGGAGTGGGCAGGG + Intronic
1002741158 5:181436742-181436764 GGACGGGGGCAGAGTCGGCAGGG + Intergenic
1003092843 6:3118663-3118685 GCTTCGGGGCAGAGTGGGCCGGG + Intronic
1003149522 6:3537091-3537113 GGCACGTGGCAGAGTCCACAAGG + Intergenic
1003939950 6:11014571-11014593 GGCAAGGAGGATAGTGGGCATGG - Intronic
1003940418 6:11019647-11019669 GGCAAGGAGGATAGTGGGCATGG + Intronic
1004043874 6:12008928-12008950 GGCGTGGGGCAGAGTTGGCAGGG + Intronic
1006072855 6:31509355-31509377 GGCAGGGCCCACAGTGGGCAGGG + Intronic
1006115611 6:31774623-31774645 GCCACTGGGAAGAGAGGGCAGGG + Exonic
1006167440 6:32073412-32073434 GGCGGGGGGCAGAGTGGAGATGG + Intronic
1006288218 6:33114075-33114097 GGGAGTGGGTAGAGTGGGCAGGG + Intergenic
1006295325 6:33167584-33167606 GGCAGGGGGCAGAGGGTCCAAGG + Intronic
1006303199 6:33204851-33204873 GGCACGGGGAGGAGAGGGCAGGG - Intronic
1006379485 6:33689210-33689232 GGCCAGGGGCAGGGTGAGCAGGG - Intronic
1006415418 6:33900838-33900860 GGCTGGGGGCAGAGTTGGAAGGG + Intergenic
1007257187 6:40537566-40537588 GACAAGGGTCAGAGTGGTCAGGG - Intronic
1007505900 6:42335144-42335166 GGAACTGGGCAGAGTGGGAAGGG + Intronic
1007591205 6:43021790-43021812 GGCATGGGGCAGGGCGGGCTGGG + Intronic
1007733276 6:43964895-43964917 GGCCCAGTGCAGATTGGGCAAGG - Intergenic
1007756708 6:44104190-44104212 GGCACAGGGCAGGGTGGAAAAGG + Intergenic
1008598456 6:53065732-53065754 GGGGCGGTGCAGAGGGGGCACGG + Intronic
1008796097 6:55304893-55304915 GGCAAGGGGCAGAATGGACAGGG - Intergenic
1009901633 6:69813952-69813974 GGCACAGAGCAGAGTGGAGAAGG + Intergenic
1010792074 6:80075981-80076003 GCCACTGGCCACAGTGGGCAGGG + Intergenic
1012314335 6:97767203-97767225 GTCAGGGGGCAGGGTGGGGAGGG - Intergenic
1012760704 6:103297015-103297037 AGCAGGAGGAAGAGTGGGCAGGG + Intergenic
1012935413 6:105362855-105362877 AGCAAGGGGCAGAGGAGGCAGGG + Intronic
1015310549 6:131762397-131762419 GGGCCGGGGCAGCGGGGGCAGGG - Intergenic
1015477712 6:133671964-133671986 GGCATGGGGCATAGTGGTGAAGG - Intergenic
1016809681 6:148247839-148247861 GGGAGGGGCCAGAGTGGCCAGGG - Intergenic
1017019791 6:150130887-150130909 GGCAAGGGGTGGAGAGGGCAGGG + Intergenic
1017913998 6:158818502-158818524 GGCCCGGGAGAGAGAGGGCAGGG + Intronic
1018053219 6:160029727-160029749 GGCTTGGGGCAGGGTGGGCCTGG + Intronic
1018907271 6:168082873-168082895 GGCCTGGGGCAAGGTGGGCAGGG + Intergenic
1018973583 6:168546543-168546565 GGCACGGGGTGGAGGGGACAGGG - Intronic
1019125881 6:169839917-169839939 GGCATGGCGTGGAGTGGGCATGG - Intergenic
1019125980 6:169840311-169840333 GGCATGGTGTGGAGTGGGCATGG - Intergenic
1019246272 6:170712439-170712461 GGACGGGGGCAGAGTCGGCAGGG + Intergenic
1019293550 7:261990-262012 CCCACGCGGCAGGGTGGGCACGG - Intergenic
1019322214 7:420920-420942 GGGACGGGGGAGAGTGGGCGGGG - Intergenic
1019384459 7:746686-746708 GACCCTGGGCAGGGTGGGCAGGG - Intronic
1019512086 7:1422704-1422726 GGCAGGGGGCAGCGTCTGCAGGG - Intergenic
1019541695 7:1554591-1554613 GGGGCTGGGCAGAGAGGGCAGGG - Intronic
1019609606 7:1930099-1930121 GGGACGTGGCAGTGGGGGCAGGG - Intronic
1019705025 7:2493490-2493512 GGCCTGGGGCGGAGTGGGGAGGG + Intergenic
1019724665 7:2594807-2594829 GGCACAGGGCAGGGTGGGGCGGG - Intronic
1019733574 7:2639902-2639924 GCCACGGGGCACGGTGAGCAGGG - Intronic
1019733765 7:2640699-2640721 GCCTGGAGGCAGAGTGGGCATGG + Intronic
1019751116 7:2730428-2730450 GGCATGGGGCAGGGTGGGAAGGG + Exonic
1019919743 7:4155930-4155952 GGCACGGGGGACAGCAGGCAGGG + Intronic
1021332267 7:19353383-19353405 GGCATGTGGCATAGAGGGCATGG - Intergenic
1022427895 7:30285339-30285361 GGCCCGGGGCAGGGCGGACATGG + Exonic
1023208092 7:37773156-37773178 GGCAGGGGGCAGAGTGGGAATGG - Intronic
1023828819 7:44027856-44027878 GCCCCGGGGCAGGGTGGGCAGGG - Intergenic
1023834448 7:44060096-44060118 GGCCAGGGGCTCAGTGGGCAAGG + Exonic
1023872674 7:44271262-44271284 GGCAGGGTGCAGAGTGTGCCTGG - Intronic
1023931229 7:44707844-44707866 GGGAGGGGGCAGTGAGGGCAGGG - Intronic
1024544855 7:50508617-50508639 GGCAAGGGGCACATTTGGCAGGG - Intronic
1024765517 7:52653275-52653297 AGCACTGGGCAGTGGGGGCATGG - Intergenic
1024991037 7:55234626-55234648 GGCACGGGGCAGCCCAGGCAGGG + Intronic
1025941605 7:66079419-66079441 GGCATGGGACAGAGTGGGGAGGG - Intronic
1025983310 7:66425799-66425821 GGCAAGGGGGATAGTGGGGATGG + Intergenic
1026031893 7:66801515-66801537 GGCATGGGGGATAGTGGGGATGG - Intronic
1026145042 7:67739450-67739472 GGCAGGGGGCAGGTTGGACATGG + Intergenic
1026292977 7:69025387-69025409 GCCACGCTGCAGAGTGGGCATGG - Intergenic
1028837827 7:95394500-95394522 TGCATGGGGCAGAGTGGACGGGG + Intronic
1029384066 7:100232054-100232076 GGCAGGGGGCGGGGTGGGGAGGG + Intronic
1029435824 7:100563623-100563645 GGTACGTGGCAGGGAGGGCATGG - Intronic
1029438612 7:100575561-100575583 GGCAGGGGGCATGCTGGGCAGGG + Intronic
1029739118 7:102482113-102482135 GCCCCGGGGCAGGGTGGGCAGGG - Intergenic
1029757119 7:102581292-102581314 GCCCCGGGGCAGGGTGGGCAGGG - Exonic
1029775060 7:102680353-102680375 GCCCCGGGGCAAGGTGGGCAGGG - Intergenic
1030161342 7:106511373-106511395 GGCAAGAGGCAGAGTGGGCAGGG - Intergenic
1031800352 7:126235713-126235735 GGAAGTGGGCAAAGTGGGCAGGG - Intergenic
1032074310 7:128829409-128829431 GACCAGGGGCAGAGTGGTCAGGG - Intergenic
1032076199 7:128837274-128837296 GGCAGGGGGGAAAGGGGGCAGGG + Intronic
1032080528 7:128856383-128856405 GGCAGGGGCCAGGCTGGGCATGG + Intronic
1032091576 7:128914167-128914189 GGCAGGGGCCAGGCTGGGCATGG - Intergenic
1032281975 7:130511145-130511167 GGCAAAGGGCAGAGTGGGAAAGG + Intronic
1033170099 7:139076494-139076516 GGCAGGGGGCAGGGCAGGCATGG - Intronic
1033262794 7:139858147-139858169 GCCATGGGGCAGAGTGAGCATGG - Intronic
1034422144 7:150995834-150995856 GGGACGGGGCAGAGGGAGGAGGG - Intronic
1034491632 7:151396054-151396076 CCCACGGGGCAGAGTAGGCTAGG + Exonic
1034550213 7:151815571-151815593 GGCAGGAGGCAGAGGGAGCAAGG - Intronic
1034781954 7:153888536-153888558 GGCACGGGGCCGAGGGGTCAGGG + Intronic
1034983345 7:155491924-155491946 GGCTCGGGGCAGAGAGGAGAGGG + Intronic
1035187577 7:157138671-157138693 GGCACGCGGCGGAGTGGGCGGGG - Intergenic
1035255358 7:157622474-157622496 GGAACGGGCCCCAGTGGGCAGGG - Intronic
1035501800 8:95250-95272 GGACGGGGGCAGAGTCGGCAGGG - Intergenic
1036390359 8:8319129-8319151 GGCAGGGGGGTGTGTGGGCAGGG + Exonic
1036767526 8:11558215-11558237 GGCAGGAGGCACAGTGGCCAGGG - Intronic
1037150029 8:15626102-15626124 GACACAGGGCACAGGGGGCACGG - Intronic
1037815070 8:22107804-22107826 GGCTCGCAGCGGAGTGGGCAGGG + Exonic
1038063099 8:23934219-23934241 GGCACCGAGCAGACTGGGAAAGG - Intergenic
1038321180 8:26528766-26528788 GGCAGGAGGCAGAGGGAGCAGGG + Intronic
1040549537 8:48427768-48427790 GGCACGGGGCAGGTGGGGCATGG - Intergenic
1040564391 8:48552964-48552986 AGCACCAGGCAGAGTGGGCAAGG + Intergenic
1041167075 8:55101717-55101739 AGGACGGCGGAGAGTGGGCACGG - Intergenic
1041345040 8:56888549-56888571 GGCACTGAGCACAATGGGCAAGG + Intergenic
1041526817 8:58815619-58815641 GGTACAGGGCCGAGTGGGCCTGG + Exonic
1043907881 8:85828744-85828766 GGCATGGGTCAGAGTGGGTGGGG + Intergenic
1045269402 8:100649416-100649438 GGCTGGGGTCAGGGTGGGCAGGG - Intronic
1045320799 8:101080343-101080365 GGCCCAGGGCAGAGAGGTCAGGG + Intergenic
1047496041 8:125409606-125409628 AGCACAGGTCAGAGTGAGCATGG - Intergenic
1047726710 8:127690235-127690257 GTGACGGGGCAGAGTGAACACGG - Intergenic
1048559287 8:135515496-135515518 GGCACAGAGCAGAGTAGGAAGGG - Intronic
1048810801 8:138284312-138284334 GCCACTGGGCAGAGTGGTCCAGG - Intronic
1049164695 8:141118692-141118714 GTGACAGGGCAGGGTGGGCAGGG + Intronic
1049184867 8:141244847-141244869 CGCACAGGGCTGAGTGGGCCTGG - Intronic
1049186614 8:141258273-141258295 GGCACGGAGCAGAGTGAGGCTGG - Intronic
1049209145 8:141377292-141377314 GGGAGTGGGCAGACTGGGCATGG + Intergenic
1049300741 8:141868094-141868116 GGCACAGGGGAGAGAGGACAGGG - Intergenic
1049301952 8:141875419-141875441 GGCACGAGGCAGAGCGGGGAAGG + Intergenic
1049329816 8:142044480-142044502 GACTCTGGGCAGAGTTGGCAGGG - Intergenic
1049398370 8:142412462-142412484 GGCGAGGGGCAGTGTGGGCTGGG - Intergenic
1049398377 8:142412483-142412505 GGCAAGGGGCAGTGTGGGCTGGG - Intergenic
1049405497 8:142450270-142450292 GGCAGGGGGCTGAGGGGGTAGGG - Intronic
1049441617 8:142612315-142612337 GGCATTGGGGAGAGTGGGCCGGG - Intronic
1049507913 8:143013718-143013740 GGGACGGGGCAGGCTGGGCTGGG - Intergenic
1049549507 8:143250538-143250560 GGCACGGAACACAGTGCGCACGG - Exonic
1049555483 8:143279327-143279349 GGGATGGGGCAGAGCCGGCAGGG - Intergenic
1050184910 9:2963088-2963110 TGCACGGGGCACAGTGGGTTTGG - Intergenic
1051225334 9:14892806-14892828 TGCCTGGGGCAGAGTGGGGAAGG - Intronic
1054878311 9:70119796-70119818 GGCAATGGGCAGGGTGGGGATGG + Intronic
1055964366 9:81851002-81851024 GGAATGGGGCAGAGAGGGCTGGG + Intergenic
1056659556 9:88534484-88534506 GGCAGGGCGCAGTGTGGGGAGGG + Intergenic
1056713059 9:89007244-89007266 GGCACGGAGAAGAGTGTGGAAGG - Intergenic
1056763259 9:89429120-89429142 CCCACGGGGCAGCCTGGGCATGG + Intronic
1057214846 9:93222151-93222173 GGGAAGGGGCAGAGGGAGCAGGG - Intronic
1057308401 9:93925833-93925855 GGGACGGGGGAGAGGGGACAGGG + Intergenic
1057545688 9:96019416-96019438 GGCAGTGGGAAGAGAGGGCAGGG - Intergenic
1057906715 9:98989132-98989154 CACACCGGGCAGAGCGGGCAGGG - Intronic
1059326598 9:113507559-113507581 GGCACGGGACAGTGCAGGCAGGG - Exonic
1060449828 9:123726914-123726936 GTCATGGGGCTGAGTGGGAAAGG + Intronic
1060820401 9:126658417-126658439 GGCAGGCGGCAGGGAGGGCAGGG - Intronic
1061218352 9:129234998-129235020 GGGTGGGGGCAGGGTGGGCAGGG - Intergenic
1061573290 9:131490887-131490909 CACACGGGGCGGGGTGGGCAAGG - Intronic
1061616749 9:131785318-131785340 GACAGGGGGCAGAGGGGGCAGGG + Intergenic
1061646729 9:132009017-132009039 GGCCACGGGCAGAGTGGGGAGGG - Intronic
1061929645 9:133825748-133825770 GGCACAGCACAGAGTGGCCAAGG + Intronic
1061996755 9:134190043-134190065 GGCACTGAGCAGAGTGGGATAGG + Intergenic
1062023440 9:134329775-134329797 GCCACGGGGGAGATGGGGCAGGG - Intronic
1062212702 9:135373204-135373226 GGCACGGGGCAGACAGGGAAGGG + Intergenic
1062558479 9:137128253-137128275 GGCACCGGGCAGGGTGGGGAGGG - Intergenic
1062596951 9:137303799-137303821 GGCCCGGGGCAGGGATGGCATGG + Intergenic
1062696705 9:137879374-137879396 GGCACAGGGCAGACTGGCCCAGG - Intronic
1203607036 Un_KI270748v1:67822-67844 GGACGGGGGCAGAGTCGGCAGGG + Intergenic
1186611023 X:11138828-11138850 GGCTCGGGGCAGGGGGGGCTCGG + Exonic
1187449077 X:19381248-19381270 GGGAGGGAGCAGGGTGGGCAGGG + Intronic
1188508259 X:30906680-30906702 TGCACAGGGCAGAGTGTGGAAGG + Intronic
1189002862 X:36963927-36963949 GGCACGGGATAGGGTGGCCAGGG + Intergenic
1193699584 X:84744742-84744764 GGCTTGGGGAAGGGTGGGCATGG - Intergenic
1194000658 X:88424729-88424751 GGCAGGGGGCAGGATTGGCAGGG + Intergenic
1195177071 X:102322079-102322101 GTGATGGGGAAGAGTGGGCAAGG + Intronic
1195181793 X:102365014-102365036 GTGATGGGGAAGAGTGGGCAAGG - Intronic
1196465349 X:115966916-115966938 AGCACTAGGCAGAGTGTGCAGGG - Intergenic
1197507639 X:127327488-127327510 GGCAAGGGGGAGTGTGTGCAGGG + Intergenic
1197805777 X:130397286-130397308 GGGATGGGGCAGAGTGGTAATGG - Intergenic
1199393254 X:147306218-147306240 GGCACTGGGCAGAGTTGTGAGGG + Intergenic
1199747789 X:150784931-150784953 TGCAGGGCGGAGAGTGGGCAGGG + Intronic
1200254067 X:154569969-154569991 GGGAAAGGGCAGAGTTGGCAGGG - Intergenic
1200263702 X:154634439-154634461 GGGAAAGGGCAGAGTTGGCAGGG + Intergenic
1200267156 X:154652807-154652829 GGCAGGGGGCATGGTGGGGAGGG - Intronic