ID: 1121660882

View in Genome Browser
Species Human (GRCh38)
Location 14:95634126-95634148
Sequence CTGAATTCCCAGATGGAACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121660875_1121660882 18 Left 1121660875 14:95634085-95634107 CCAGCATGGCCACTGGGTCAGAC No data
Right 1121660882 14:95634126-95634148 CTGAATTCCCAGATGGAACCTGG No data
1121660879_1121660882 9 Left 1121660879 14:95634094-95634116 CCACTGGGTCAGACTGGCAGGGT No data
Right 1121660882 14:95634126-95634148 CTGAATTCCCAGATGGAACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121660882 Original CRISPR CTGAATTCCCAGATGGAACC TGG Intergenic
No off target data available for this crispr