ID: 1121661710

View in Genome Browser
Species Human (GRCh38)
Location 14:95640081-95640103
Sequence TTGCAGAAACCCAATGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 355
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 329}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121661710_1121661716 5 Left 1121661710 14:95640081-95640103 CCTTCCTCATTGGGTTTCTGCAA 0: 1
1: 0
2: 1
3: 24
4: 329
Right 1121661716 14:95640109-95640131 CCCCACCCCAGCACTCTGCAGGG 0: 1
1: 0
2: 7
3: 64
4: 532
1121661710_1121661722 11 Left 1121661710 14:95640081-95640103 CCTTCCTCATTGGGTTTCTGCAA 0: 1
1: 0
2: 1
3: 24
4: 329
Right 1121661722 14:95640115-95640137 CCCAGCACTCTGCAGGGCCTGGG 0: 1
1: 1
2: 62
3: 1149
4: 20088
1121661710_1121661720 10 Left 1121661710 14:95640081-95640103 CCTTCCTCATTGGGTTTCTGCAA 0: 1
1: 0
2: 1
3: 24
4: 329
Right 1121661720 14:95640114-95640136 CCCCAGCACTCTGCAGGGCCTGG 0: 1
1: 2
2: 9
3: 71
4: 1012
1121661710_1121661714 4 Left 1121661710 14:95640081-95640103 CCTTCCTCATTGGGTTTCTGCAA 0: 1
1: 0
2: 1
3: 24
4: 329
Right 1121661714 14:95640108-95640130 TCCCCACCCCAGCACTCTGCAGG 0: 1
1: 0
2: 4
3: 64
4: 418
1121661710_1121661724 23 Left 1121661710 14:95640081-95640103 CCTTCCTCATTGGGTTTCTGCAA 0: 1
1: 0
2: 1
3: 24
4: 329
Right 1121661724 14:95640127-95640149 CAGGGCCTGGGAAGTGAACCAGG 0: 1
1: 1
2: 1
3: 30
4: 349

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121661710 Original CRISPR TTGCAGAAACCCAATGAGGA AGG (reversed) Intergenic
902632307 1:17712310-17712332 AGGCAGAAACCCATTGAGGTGGG + Intergenic
902711604 1:18243703-18243725 TTACAGAACCCAAATGAGGCTGG - Intronic
903311737 1:22464128-22464150 TTCCAGCAGCCCAATGAGAAAGG + Intronic
903475134 1:23614283-23614305 TTCCAGGAACCTAATGAGGGTGG + Intronic
903671240 1:25036890-25036912 TTGTAGTAACCCTATGAGGTGGG + Intergenic
905008318 1:34729240-34729262 TTGCAGAGACCCACGGAGGTAGG - Intronic
906527811 1:46506617-46506639 TTGCAGCAACCCTATGAGATAGG + Intergenic
906639026 1:47430381-47430403 TTACAGCAATCCAATGAGGTAGG + Intergenic
907052164 1:51336794-51336816 TTGCAACAACCTAATGAGGTTGG - Intronic
910374728 1:86555578-86555600 ATGCAGTAACCCAAAGAGCATGG - Intronic
910905288 1:92170922-92170944 TTGCAGATATATAATGAGGAAGG - Intronic
911940716 1:104044127-104044149 TTCCAAAAACTCAAGGAGGAGGG - Intergenic
912614393 1:111083491-111083513 TTGCAAAAAGTCAAGGAGGAAGG - Intergenic
913444054 1:118930927-118930949 TTACAGGAACCCTATGAGGTTGG - Intronic
913469966 1:119177652-119177674 ATGCAAAAACCCAAAGAGGTGGG + Intergenic
915301293 1:154953061-154953083 GGGCAGAAGCCCACTGAGGAGGG - Intronic
915492216 1:156257263-156257285 TTGCAGCAGCCCAGTGAGGTAGG - Intronic
916245641 1:162685781-162685803 TTGCAGCAATCCTATGAAGAAGG + Intronic
916951641 1:169786095-169786117 TTTCAGAAACACAAAGAGGGAGG + Intronic
919674550 1:200368182-200368204 TTACAACAACCCAATGAGGTAGG + Intergenic
919676778 1:200391740-200391762 TTGGGGAAACAAAATGAGGAAGG + Intergenic
920223867 1:204424111-204424133 TGGCAGAACCCCAATACGGAAGG + Exonic
920889668 1:209971920-209971942 TTCCAGAAAAACAAGGAGGAGGG - Intronic
921562753 1:216677945-216677967 TTGCAGCATCAGAATGAGGAAGG - Intronic
922084026 1:222328242-222328264 TTACAGAAGCCAAAGGAGGAGGG - Intergenic
922716761 1:227880153-227880175 TTGCAAGAACCCAAAGAGAAGGG + Intergenic
922950467 1:229554813-229554835 TTCCTGAAGCCCAGTGAGGATGG - Intronic
1063321279 10:5054900-5054922 GTGCAAAAACCCAAGGAGGTGGG - Intronic
1064821976 10:19346948-19346970 CTGCATAAAACCAATGAGGGAGG - Intronic
1065298547 10:24300122-24300144 CTGCAGATGCCCAGTGAGGAAGG - Intronic
1067280579 10:44869138-44869160 GTGCAGAGACGCAATGGGGAGGG + Intergenic
1069936953 10:71924175-71924197 TTGCAGAATCCCAAGCAGGGAGG + Intergenic
1071769968 10:88717448-88717470 TTGCAACAACCTCATGAGGAAGG + Intergenic
1072375786 10:94814246-94814268 TTAAAGAAACTCAATCAGGAGGG - Intronic
1072380430 10:94863354-94863376 TTGCAGAAACCTGATGAGATTGG - Intergenic
1072389662 10:94969897-94969919 TTAAAGAAACTCAATCAGGAGGG - Intronic
1072664399 10:97383413-97383435 TCACAGCAACCCCATGAGGAAGG - Intronic
1073466883 10:103699531-103699553 TTCCAGAAACCAAGTGAGGAAGG + Intronic
1074598255 10:114887431-114887453 TTACAAAAACCCTATGAGGGAGG + Intronic
1074716238 10:116222065-116222087 TTTCATAAACCCAAGTAGGATGG - Intronic
1077463883 11:2724349-2724371 GTGCAGAAACCCAATCCGGGCGG - Intronic
1077575943 11:3383582-3383604 TGACAGAAACTGAATGAGGAGGG + Intergenic
1078457907 11:11489772-11489794 TTGTAGCAACCCAATAAGGTAGG + Intronic
1079074301 11:17374099-17374121 GTGCAAAAATCCAATGGGGAAGG + Exonic
1079396245 11:20066468-20066490 TTGCAGAAACTCCATTAGGTAGG - Intronic
1080309780 11:30876368-30876390 TTGCAGCCAACCAAAGAGGAAGG + Intronic
1080376221 11:31715775-31715797 TTGTAACAACCCAATGAGGCAGG - Intronic
1081451471 11:43174624-43174646 TTGTGGAAACCAAATGAGGCTGG - Intergenic
1081616503 11:44594569-44594591 TTGCAGCAACCCCAGGAGGTGGG - Intronic
1082177406 11:49077080-49077102 CTGCAGAAACCTAATCAGGGAGG + Intergenic
1083198025 11:61102559-61102581 TTGCAGAGACCCCATGGGCATGG - Exonic
1084035219 11:66505567-66505589 TTGCAGTAGCCCAATAAGGTAGG + Intronic
1084035693 11:66508893-66508915 TTACAGTAACCCTGTGAGGAAGG - Intronic
1084497749 11:69514862-69514884 TTCCAGGAGCCCAGTGAGGAAGG + Intergenic
1084589636 11:70083271-70083293 TTCCAGCAACCCCATGAGGGAGG + Intronic
1085280877 11:75329651-75329673 TGTCAGAAACCCTCTGAGGATGG - Intronic
1085837308 11:79970852-79970874 TTGCAGAAACCCACAGAGCTGGG - Intergenic
1086201006 11:84202228-84202250 CTGCAGTAACCAAAAGAGGATGG + Intronic
1086526499 11:87733453-87733475 TTACAGTAACCCAAACAGGATGG - Intergenic
1087229319 11:95641870-95641892 TGGCCAAAAACCAATGAGGAAGG + Intergenic
1087288876 11:96298311-96298333 TTGCAGAGAAACAGTGAGGATGG + Intronic
1088520866 11:110698455-110698477 TTCTAAAAAACCAATGAGGAGGG - Intronic
1089872140 11:121685098-121685120 TTGCAAAAACCAAATGACTACGG + Intergenic
1090046281 11:123337243-123337265 TTGCAGAAACTCAAAATGGATGG + Intergenic
1091965845 12:4740743-4740765 TTACAACAACCCTATGAGGAAGG + Intronic
1092255177 12:6922990-6923012 GTGCGGAACCCCAATGAGTAGGG - Exonic
1092964146 12:13625494-13625516 TTGCAGAAAACTAATGAGCCCGG - Intronic
1093338696 12:17943486-17943508 TAGCAGAATCCCAATGAGGGAGG + Intergenic
1093700491 12:22214821-22214843 TTGCAGTAACTCTATGAGGAAGG + Intronic
1095617586 12:44210316-44210338 TTTTAAAAATCCAATGAGGATGG - Intronic
1098873156 12:75839211-75839233 TTGCAGAAACCAAACAAGAAAGG - Intergenic
1099010500 12:77285649-77285671 TTCCAGAAACCCAAAGCAGAGGG + Intergenic
1101016783 12:100509561-100509583 TTACATCAACCCAATGAGGTAGG + Intronic
1101080118 12:101173267-101173289 GTGCAGGAACCCAAAGAGAAAGG - Intronic
1101187795 12:102298252-102298274 TTCCAAAAACTCAAGGAGGAGGG - Intergenic
1102206239 12:111092726-111092748 TTGCAGTGACCCTCTGAGGAAGG + Intronic
1102479704 12:113213506-113213528 TTGCAACAACCCTATGAGGTAGG + Intronic
1103277006 12:119720511-119720533 TTGCAGAAAATCAATGAGTTTGG + Exonic
1104896703 12:132168380-132168402 TTGCAGAAAGCCCATGGAGAAGG - Intergenic
1105631553 13:22174657-22174679 TTGCAGAAACCCACAGTGGCAGG + Intergenic
1106196776 13:27500894-27500916 TGGCCGACACCCAATGAGGAGGG - Intergenic
1106691286 13:32120109-32120131 TTAAATAAAACCAATGAGGAGGG - Intronic
1107617973 13:42191991-42192013 TCGCAGCAACCCAATGAAGTAGG - Intronic
1107875160 13:44783787-44783809 TTGCAGTAACCAAAAGAGGAAGG + Intergenic
1108500487 13:51065776-51065798 TTACTAAAACCCTATGAGGAAGG - Intergenic
1109087276 13:57991156-57991178 GTGCAGAAACCATACGAGGAAGG - Intergenic
1109403811 13:61871403-61871425 TTGCAGAAACAGAAGGAGAATGG + Intergenic
1112838435 13:103545997-103546019 TAGCAGAAACACCATGGGGAGGG - Intergenic
1112865151 13:103886262-103886284 TTGTACAAACCCAAGGAGGTTGG + Intergenic
1114395850 14:22359972-22359994 TTCCAAAAAACCAAGGAGGAAGG - Intergenic
1114482849 14:23046194-23046216 TTGCAGAACACAAAGGAGGAGGG - Intergenic
1117100265 14:52338750-52338772 TTGCCGAAATCCTATGAGGTGGG - Intergenic
1118434584 14:65757927-65757949 TTACAAAAACCCTATGAGGTGGG - Intergenic
1119257077 14:73208087-73208109 CTGCAGAACCCCAAAGAGGGGGG + Intronic
1120071120 14:80104262-80104284 GGGCAGAAAGCCAATGAGAAAGG + Intergenic
1120868766 14:89318660-89318682 TTGCATCAACCCTATGAGAAAGG + Intronic
1121145955 14:91582595-91582617 GTGTAGAAAACCAATTAGGAAGG - Intronic
1121484546 14:94304566-94304588 GTGCTGCAACTCAATGAGGAGGG - Exonic
1121661710 14:95640081-95640103 TTGCAGAAACCCAATGAGGAAGG - Intergenic
1122317422 14:100834455-100834477 GTCCAGAAACCCAAGCAGGATGG - Intergenic
1124683460 15:31757306-31757328 CTGCAGTAACCCTATGAGGAAGG - Intronic
1125401433 15:39308513-39308535 TTCCAAAAAACCAAAGAGGAAGG - Intergenic
1125742149 15:41972677-41972699 TGGCAGAGATCCAATCAGGAAGG - Intergenic
1126860586 15:52878906-52878928 TTGCAGAAATCCTAAGAGGAAGG - Intergenic
1127213090 15:56795571-56795593 TTGCAGTAATCCAATGTGGCTGG - Intronic
1128008090 15:64264479-64264501 TTTCAAAAAACCAAAGAGGAGGG + Intronic
1128270997 15:66309561-66309583 TTGCAACAACCCTATGAGGTAGG + Intronic
1129654957 15:77517927-77517949 TTGTAGCAACCCTATTAGGAAGG - Intergenic
1129962042 15:79696081-79696103 TTACAGAAACAAAATGAAGAAGG - Intergenic
1130436085 15:83901337-83901359 TTCCAGAGACCAAAGGAGGAAGG + Intronic
1130863480 15:87911461-87911483 TTCTAGAAACCCAATGGGGATGG + Intronic
1131125998 15:89857466-89857488 TTGCAGAAAGCCTCTAAGGAGGG + Intronic
1132420420 15:101661230-101661252 TGGCACAAACTCAAAGAGGATGG - Intronic
1132611658 16:819749-819771 TTTCCAAAACCCAATGAGGCAGG - Intergenic
1132998708 16:2838363-2838385 TTCCAGAAATCTAGTGAGGAGGG - Intronic
1133906600 16:10028163-10028185 TTGCAGCAACTCTATGAGGCAGG + Intronic
1133912700 16:10080377-10080399 TTGCAGAAAGCGAAGGTGGAAGG + Intronic
1133950744 16:10390197-10390219 ATGGAGAAACCCAATGAAGCAGG + Intronic
1133958515 16:10469502-10469524 TTGCTGAAAGTCAGTGAGGAAGG + Intronic
1135172301 16:20196140-20196162 TTGCAGAAAATAAAAGAGGAAGG - Intergenic
1137392205 16:48091245-48091267 CTGCAGAACCCGAAGGAGGAAGG - Intronic
1137534484 16:49307873-49307895 CTACAGCAACCCAGTGAGGATGG + Intergenic
1138352641 16:56354066-56354088 TTAAAGGAAACCAATGAGGAAGG + Intronic
1139062813 16:63275181-63275203 TTTCAAAACACCAATGAGGAGGG - Intergenic
1139478733 16:67216494-67216516 TTGCAGAACCCCAGTGGAGATGG - Intronic
1139941618 16:70609775-70609797 TTTCAGCAACCCCATGAGGCTGG + Intronic
1140123551 16:72103003-72103025 GGGCAGCAACCCAATCAGGAAGG + Intronic
1141094650 16:81154366-81154388 ATGCAGGAACCCACTGAGCAAGG - Intergenic
1141106977 16:81241967-81241989 TTGCAGCAACCCTATGTGGGAGG - Intronic
1144832055 17:18137243-18137265 TTACAGCAACCCTATGAGGCAGG + Intronic
1145005020 17:19332818-19332840 TTGGGGAAACCCCGTGAGGAAGG - Intronic
1147520037 17:41162277-41162299 TTAAAGAAACCCAAGGAAGAAGG + Intergenic
1147920505 17:43913756-43913778 TAGGTGAACCCCAATGAGGAGGG - Intergenic
1148236367 17:45971867-45971889 CTGCAGACCCCCACTGAGGACGG + Exonic
1148549292 17:48541263-48541285 TTAAAGAAACCTAAGGAGGATGG + Intronic
1148585412 17:48775166-48775188 TTGCAGAAAACAAAAGAGAAAGG + Intronic
1149020147 17:51954021-51954043 TTGCAGAAAACAAATGATAATGG - Intronic
1150288483 17:63967487-63967509 CTGCAGTAACCCTTTGAGGAAGG + Intronic
1150673327 17:67221673-67221695 TTGCAGTAACCCTAGGAGGTAGG - Intronic
1151123828 17:71823306-71823328 TTGGAAATACCCAATGTGGATGG + Intergenic
1152274140 17:79344475-79344497 ATTGAGAAGCCCAATGAGGAAGG - Intronic
1155437273 18:25826442-25826464 TGGAAGAAACCCACGGAGGAAGG - Intergenic
1155645617 18:28073871-28073893 TTGCAGCAACCCCAGGAGCAAGG - Intronic
1155712104 18:28894787-28894809 TTACAGAAAACTAAAGAGGAGGG + Intergenic
1155813978 18:30280137-30280159 TTGCAGAAAATCCATTAGGAAGG - Intergenic
1156268496 18:35509704-35509726 TTCCAGAAAATCAAAGAGGAGGG - Intergenic
1156305530 18:35875009-35875031 TTGCAGAAATCCAATGGGGAGGG + Intergenic
1156609612 18:38711148-38711170 TTACAATAACCCAATGAGGTAGG + Intergenic
1157127887 18:44974433-44974455 CTGCAGAAAGGCAAAGAGGAGGG + Intronic
1157161425 18:45317715-45317737 CTCCAGAAACCCAAAAAGGATGG - Intronic
1157334226 18:46725770-46725792 TCAAAGAAACCCAATGAGGAAGG + Intronic
1158173057 18:54620727-54620749 TTGCAGAAATAAAATGTGGAAGG - Intergenic
1161592954 19:5136928-5136950 GTGCAGACACCCAACAAGGAGGG + Intronic
1161879577 19:6938730-6938752 TTGCAGAAGTCCAGTGAGGTAGG + Intronic
1162112388 19:8406602-8406624 TTGCAACAACCCAACGAGGTGGG + Intronic
1163635663 19:18436164-18436186 CTGCGGAGACCCATTGAGGAAGG + Exonic
1164356254 19:27434847-27434869 TTGCAGATACTATATGAGGAAGG - Intergenic
1166371763 19:42305719-42305741 TTCTAGCAACCAAATGAGGAAGG + Intronic
1166613086 19:44217359-44217381 TTGGAAAAACCCTATGAGGGAGG + Intronic
925347665 2:3182118-3182140 ATGCAGAAATCCAATCAGCAAGG + Intergenic
925656255 2:6152764-6152786 TCGCAGACACCCTATGAGGTAGG + Intergenic
926055509 2:9771686-9771708 TTTGAGAAACCCAGTGAGAAGGG + Intergenic
928213538 2:29341946-29341968 TGGGAGAAACCTAATGAAGAAGG + Intronic
928299320 2:30111592-30111614 TTTCAGAAACAAAATGATGAAGG - Intergenic
929273229 2:39997467-39997489 TTGTTGAAACCCAATCATGATGG + Intergenic
930389532 2:50743560-50743582 TTCCAGAAATCCAATGAGAAAGG + Intronic
930625600 2:53694098-53694120 TTACAAAATCTCAATGAGGAGGG + Intronic
930747626 2:54901118-54901140 TTGTAGGAACCCCATGAGTAAGG + Intronic
931036021 2:58243759-58243781 TTGAAGAAATCCAATGACCAAGG + Intergenic
931159644 2:59674596-59674618 TTACAGCAACCCAATGAAGTAGG - Intergenic
931480858 2:62638338-62638360 TTGCAGTAACCAAAAGAGTATGG + Intergenic
931984477 2:67728292-67728314 TTTCAGAAACACAATAAAGATGG + Intergenic
932104948 2:68933688-68933710 CTGCAGAAACCCAATACTGAGGG - Intergenic
932216004 2:69966310-69966332 AGGCAGAAACCCAATTCGGAGGG - Intergenic
933101393 2:78262720-78262742 TTACAGAAGTACAATGAGGAGGG + Intergenic
934139436 2:89031450-89031472 TTGCACAAACACAATTAGCAGGG + Intergenic
934229803 2:90169093-90169115 TTGCACAAACACAATTAGCAGGG - Intergenic
934582470 2:95455411-95455433 CTGCAGAAACCTAATAAGGGAGG - Intergenic
934596980 2:95621303-95621325 CTGCAGAAACCTAATAAGGGAGG + Intergenic
934842895 2:97641700-97641722 CTGCAGAAACCTAATAAGGGAGG - Intergenic
935209369 2:100925279-100925301 TTGCAGAAACACAATGGTAAAGG + Exonic
935311599 2:101789087-101789109 TGACAGAAACCAAATGATGAGGG - Intronic
935349037 2:102137961-102137983 TTGCAGAAAACCAAAGATGGTGG + Intronic
936843074 2:116797476-116797498 TTGCACATACCCCTTGAGGACGG + Intergenic
937539487 2:122931077-122931099 TTGCCCAAACAAAATGAGGATGG - Intergenic
937669966 2:124528046-124528068 CTGCAGAAAACCAAAGAGGATGG + Intronic
938113167 2:128583351-128583373 TTCCAGAAAACAAAAGAGGAAGG - Intergenic
940119279 2:150245345-150245367 TTGCACCAACCCATTCAGGAGGG + Intergenic
940885857 2:158988770-158988792 CTGCAAAAACCCCATGAGGTAGG - Intronic
941108317 2:161388530-161388552 TTGCAGAAGGCAAAAGAGGAAGG - Intronic
941469118 2:165862503-165862525 TAGCAGAAACCAACTTAGGATGG - Intronic
945222881 2:207502690-207502712 TGCCAAAAACCCCATGAGGAGGG + Intergenic
1170709645 20:18778789-18778811 TCACAGCAACCCAATGAGGGAGG - Intergenic
1170797837 20:19565141-19565163 TTCCACAAACCCACAGAGGAGGG - Intronic
1172274316 20:33671502-33671524 TTGAAGAGACCCAAGGAGAAGGG + Intronic
1174522422 20:51141929-51141951 TTGCAGCAACTCTATGAGGCAGG - Intergenic
1174725341 20:52855838-52855860 ATGAAGAAAAACAATGAGGAAGG - Intergenic
1175413374 20:58785925-58785947 TTGCTGGAACCCAAAGAAGAGGG + Intergenic
1177425404 21:20916365-20916387 TTCCAAAAACCCAAGGAGTAGGG + Intergenic
1180062096 21:45390779-45390801 TTACAGAAACCCCTTGAGGGAGG + Intergenic
1180220136 21:46353342-46353364 TGGCAGAAACTCACTGAGGCTGG - Intronic
1181866735 22:25864004-25864026 TGGCAGGAAACAAATGAGGAAGG - Intronic
1182459046 22:30471515-30471537 TTTCAGGATCCCAAAGAGGAAGG + Intronic
1182704506 22:32268411-32268433 CTGAAGGAACCCCATGAGGAAGG + Intergenic
1182799617 22:33020937-33020959 TTGCAGGAACTCTATGAGGTAGG - Intronic
1183204049 22:36406212-36406234 TTGCAACAACCCTATGAGGTAGG + Intergenic
1184010618 22:41745267-41745289 TAGCAAAAACTCCATGAGGAAGG - Intronic
1184568602 22:45308630-45308652 TTGGAACAACCCTATGAGGAAGG - Intergenic
1184695664 22:46137542-46137564 TTTCAGCAACCGAATGAGGTAGG + Intergenic
949143490 3:664957-664979 GTGCAGATGCCCTATGAGGATGG - Intergenic
950899981 3:16488820-16488842 TTGCAGTAACCCAGTAAGGTAGG - Intronic
951359517 3:21708314-21708336 TTACAGCAACACAATGAGGGTGG + Intronic
952056362 3:29451644-29451666 TTGCACAAAACCACTGGGGAAGG + Intronic
952453467 3:33451978-33452000 GTGCAAAAACCCAAAGAGGTGGG + Intergenic
952929658 3:38349236-38349258 TTGAAGAAAGCCAATGATGCTGG + Intronic
953824510 3:46239184-46239206 TTGGAGAAAAACAAAGAGGACGG - Intronic
954330043 3:49884966-49884988 CTGCAGAAGCTCAATGGGGAAGG + Intergenic
955362589 3:58288393-58288415 ATGCAGAAACCCTCTCAGGAAGG - Intronic
956185155 3:66555445-66555467 TTGCAGAAACCCCTTGAAGAAGG - Intergenic
956655884 3:71549794-71549816 TTGCTGAAAGCCCTTGAGGATGG + Intronic
956740719 3:72273669-72273691 TTTAAGAAACACAATTAGGAAGG + Intergenic
957351597 3:79030213-79030235 TTGCAGAATGTCAATGGGGAGGG - Intronic
958071047 3:88611935-88611957 TGGCAGAAATCCAAAGATGAAGG - Intergenic
958087014 3:88822781-88822803 TTGCAGAAACGCAGAGAAGATGG - Intergenic
959825279 3:110787271-110787293 TTGCAGAGACACAATGAAAAAGG - Intergenic
960245746 3:115398574-115398596 TTGCAAAAGCCCACTGATGAAGG + Intergenic
961038269 3:123658660-123658682 TTGCAAAAACCCTAAGAGGTAGG - Intronic
961205329 3:125076838-125076860 ATCCAGAGACCCCATGAGGATGG - Intergenic
962837199 3:139199863-139199885 TTGCAGAAACCCCCTTAGGAAGG - Intronic
963069437 3:141290822-141290844 TCACAAAAACCCAATGAAGAAGG - Intronic
964549032 3:157866220-157866242 TTTCACAAACCCAATAAGGAGGG + Intergenic
964809364 3:160646828-160646850 TTGTAACAACCCAATGAAGAAGG + Intergenic
965499439 3:169440469-169440491 CAGGAGAAACCCAATGAGCAAGG + Intronic
966259391 3:177956902-177956924 TTTCAGAGATCCAAGGAGGAAGG - Intergenic
966723033 3:183083586-183083608 TTGCTGTAACACAATGAGAAAGG - Intronic
968683105 4:1935414-1935436 TTACAGAACCCCATTGAGAAAGG + Intronic
969855457 4:9995515-9995537 TTACAGAAACCCGATTAAGAAGG - Intronic
971263542 4:25077924-25077946 TTACAGAAACCCAGTGGGGGAGG + Intergenic
971513483 4:27457246-27457268 TAGCAGAAACCAAAAAAGGAAGG - Intergenic
971609657 4:28706696-28706718 TTGCAGAAACCCAATTTAGTAGG + Intergenic
971618201 4:28821367-28821389 CTGCAGTAACTCCATGAGGAAGG + Intergenic
971627096 4:28935396-28935418 TTGCAGAAAACAAATGACTAGGG + Intergenic
971801086 4:31291982-31292004 TTCCAGAAAACCAAAAAGGAGGG - Intergenic
972638679 4:40906548-40906570 TTTCAGAGTCCCAATGAGGAGGG + Intronic
974977573 4:68909525-68909547 TTTCAGCAACCCCATGAGGTCGG + Intergenic
975174525 4:71272337-71272359 TCCCAGAAGCCCAATAAGGAAGG + Intronic
975595402 4:76044854-76044876 GTGCAGGAACCCAAAGAGGTGGG - Intronic
976015332 4:80545701-80545723 TTGCAAAAAATCAAGGAGGAGGG + Intronic
976138601 4:81965711-81965733 TTGCAACAACCTAATGAGGTGGG - Intronic
977761895 4:100747614-100747636 TAGCAGAAACCCTATGAGCCAGG + Intronic
978192505 4:105931113-105931135 GTACAGAAACTCAAGGAGGAGGG - Intronic
979806521 4:124979442-124979464 TTGCAGAAACCCTGTGAGGTAGG - Intergenic
980599564 4:135003289-135003311 TTACAGAAACCCTGTGAGAATGG + Intergenic
980897844 4:138876752-138876774 TTGCATCATCCCAAAGAGGATGG - Intergenic
984677620 4:182568374-182568396 TTGGAGAAACAGAATGAGAAGGG + Intronic
986209227 5:5654783-5654805 TTCCAAAAACTCAAGGAGGAGGG - Intergenic
986444871 5:7812598-7812620 TAACTGAAACCCAATGAGGTAGG + Intronic
986803862 5:11289675-11289697 TTACAGAAGCCCAATGATTAAGG - Intronic
987900587 5:24006116-24006138 TTGCACCAACCAAATGAGGTAGG + Intronic
988986786 5:36627932-36627954 TTGCAACAACCCCAGGAGGAGGG - Intronic
991007167 5:61840835-61840857 TTGAAAAAACCCACTGGGGATGG - Intergenic
991276093 5:64848443-64848465 TTCCAGAAAACCAAAGAGGAGGG + Intronic
991324631 5:65416838-65416860 TTCCAAAAACTCAAGGAGGAGGG + Intronic
992598578 5:78371908-78371930 TTGCTGAAATCAAATTAGGAAGG + Intronic
994673767 5:102795351-102795373 TTGCAGGAACCAAATGAGACAGG + Intronic
995479986 5:112583968-112583990 TTGCAGTAAGCCAAGGATGATGG - Intergenic
995763514 5:115589506-115589528 TTGCAGAGAATCAATAAGGATGG + Intronic
995858396 5:116617083-116617105 TTGCAACAACCCTAGGAGGAAGG - Intergenic
996036677 5:118766157-118766179 TTACAGAAACCAAAACAGGATGG + Intergenic
996927867 5:128850013-128850035 TTCCAAAAAACAAATGAGGAGGG + Intronic
997376235 5:133399601-133399623 TCACAGAACCCCACTGAGGATGG - Intronic
998236125 5:140400561-140400583 TAACAACAACCCAATGAGGAAGG + Intergenic
998678654 5:144439230-144439252 TTGGAGAAATACAATGATGAGGG + Intronic
999065118 5:148677175-148677197 TTGCTGAAGCCCAAAGAGGTGGG + Intronic
999754655 5:154655358-154655380 TTTTAGAACCCCAATGAGGAAGG + Intergenic
999949357 5:156632316-156632338 TTGCAGAAACCTACTGGGGCTGG - Intronic
1001486150 5:172120958-172120980 TCGCAGTAACCCAGTGAGGTGGG + Intronic
1001872685 5:175170556-175170578 TTGCAGCAACCCAAACAGGGGGG + Intergenic
1002128414 5:177064320-177064342 TTGCAGAATTGCCATGAGGATGG + Intronic
1003119387 6:3307366-3307388 TTTCAGAAACCCCTTCAGGATGG + Intronic
1005066351 6:21821554-21821576 TTGCAGTAACCCACTGTGGTGGG - Intergenic
1005321835 6:24663216-24663238 TTACAACAACCCCATGAGGAAGG + Intronic
1005725956 6:28648990-28649012 TTGAAGAACCAAAATGAGGAAGG - Intergenic
1009849405 6:69176661-69176683 TTGCAAAAAATCAAGGAGGAAGG - Intronic
1009879405 6:69546793-69546815 TTGCAACAACCCAATGAAGTAGG + Intergenic
1011656501 6:89556801-89556823 TTGCAACAACCTAATGAGGTAGG + Intronic
1012550155 6:100458169-100458191 CGGCAGAAACCCAAGGAGGGCGG + Intronic
1012624217 6:101387354-101387376 TTGCAGAAAGCTACTAAGGAGGG - Intergenic
1013472082 6:110474927-110474949 TTACAGTAACTCAATGAGGTAGG - Intronic
1013959335 6:115880258-115880280 TCACAGCAACCCAATGAGGTAGG + Intergenic
1014003321 6:116389210-116389232 TCACAGAAACCCTATGAGGGAGG + Intronic
1014462866 6:121719003-121719025 TTGCAAAAACACAATTAGGATGG + Intergenic
1014537717 6:122635202-122635224 TTACAGTAACTCTATGAGGAAGG + Intronic
1016250385 6:142034270-142034292 TTCCAGAAATCCAATGAGGCTGG + Intergenic
1016474547 6:144412564-144412586 TTGCAAAAAACAGATGAGGAGGG + Intronic
1018288581 6:162266810-162266832 TTTCAGAAAACTAAAGAGGATGG + Intronic
1018811239 6:167299942-167299964 GGGCAGAGACCCACTGAGGACGG + Intronic
1019000797 6:168749380-168749402 TTGCAGAAACCCAAATAGAGTGG - Intergenic
1019340243 7:505475-505497 CTGCAGAGACCCCCTGAGGAGGG + Intronic
1020988299 7:15163859-15163881 TTTCAGAAAATCAAAGAGGAGGG - Intergenic
1023085848 7:36569237-36569259 TTGCTAAAACAAAATGAGGAAGG + Intronic
1024651969 7:51411062-51411084 TTCCAGAAAATCAAGGAGGAGGG + Intergenic
1025186348 7:56862656-56862678 TTGCAGCAACCAAAGGAGGAGGG - Intergenic
1025685574 7:63714242-63714264 TTGCAGCAACCAAAGGAGGAGGG + Intergenic
1027715693 7:81666922-81666944 TTGCAAAAATCTAACGAGGATGG + Intergenic
1027766882 7:82355089-82355111 CTGCAGAGACTAAATGAGGAGGG + Intronic
1028304895 7:89250547-89250569 TTCCAGAAAATCAAGGAGGAGGG + Intronic
1033984681 7:147210128-147210150 TTCCAAAAAACCAAGGAGGAGGG - Intronic
1037576877 8:20214340-20214362 TCACAGCAACCCTATGAGGAAGG - Intronic
1037711697 8:21360338-21360360 TTGCAGAAATCTAAAGAGGTAGG + Intergenic
1037766322 8:21774550-21774572 TCGCAGCAATCCAATGAGGTCGG + Intronic
1038652477 8:29418122-29418144 TTGAAGCAACCCTATGAGGTAGG - Intergenic
1040483230 8:47845788-47845810 TTTCACAAAACCAAGGAGGAAGG + Intronic
1040978209 8:53217536-53217558 CAGCGGAAACCCAGTGAGGAGGG - Intergenic
1041397222 8:57403791-57403813 TGGCTGATACCCAATGAAGATGG + Intergenic
1043095771 8:75970191-75970213 ATGCAGAAACTCAGGGAGGAGGG - Intergenic
1043401306 8:79887375-79887397 TCACAGCAATCCAATGAGGAAGG - Intergenic
1044927457 8:97221716-97221738 TTGAAGACACACAATGAAGAAGG + Intergenic
1045832112 8:106475039-106475061 TTACAGAAATCCTATGAGGTAGG - Intronic
1046199557 8:110906250-110906272 TTGCAGAAACACTTTGAAGATGG - Intergenic
1047884568 8:129234905-129234927 TTGTAGAAACACCATGAGAAAGG + Intergenic
1049483890 8:142841350-142841372 GTGCAGAAACGCACTCAGGATGG - Intronic
1049944644 9:581846-581868 GTGCAGCAACCCCAGGAGGATGG - Intronic
1051346449 9:16155083-16155105 TTGGAGAGACCCACTGAGGTTGG - Intergenic
1052582364 9:30374249-30374271 TTGCAGAAAATAAAAGAGGAGGG + Intergenic
1053377324 9:37618684-37618706 CTGCAGTAAACCAATGAGGCTGG - Intronic
1054096931 9:60912941-60912963 TTGCAGAAATCCAGTGAAGCAGG + Intergenic
1054955593 9:70906273-70906295 TTACAGAAAATAAATGAGGAGGG + Intronic
1056703699 9:88933537-88933559 TTGAAACAACCCTATGAGGAAGG + Intergenic
1059072036 9:111147907-111147929 TTGCATAAACAAAAAGAGGATGG + Intergenic
1059091287 9:111361399-111361421 TTTCAGAAACCCAATGGTAAGGG + Exonic
1059601880 9:115787640-115787662 TGGCAGAAATTCAATCAGGAGGG + Intergenic
1060030304 9:120209130-120209152 TCACAAAAACCCAATGAGGGAGG + Intergenic
1060601011 9:124877491-124877513 TTCCGGAAACCCGATGTGGAAGG + Exonic
1060771439 9:126334945-126334967 TTGCATAAACCCCATGAGGCAGG - Intronic
1062611156 9:137374154-137374176 TTGCAGGAATCCACAGAGGACGG - Intronic
1203441760 Un_GL000219v1:15951-15973 TTCCAGAAAACCAGTGTGGATGG - Intergenic
1203512570 Un_KI270741v1:134860-134882 TTCCAGAAAACCAGTGTGGATGG - Intergenic
1187990424 X:24864965-24864987 TTGCAGCAACCCTGTGAGGTGGG + Intronic
1188119774 X:26290017-26290039 TTCCAGAAAATCAAGGAGGAAGG - Intergenic
1192363075 X:70451500-70451522 TTGCAGCAGTCCTATGAGGAAGG - Intronic
1193701772 X:84771584-84771606 TTACAGGAACCCAAGGAGGTAGG + Intergenic
1193760311 X:85457644-85457666 TTGCAAAAATCTTATGAGGAAGG - Intergenic
1194425299 X:93730293-93730315 TTACAATAACCCAATGAGGCAGG - Intergenic
1195526360 X:105894715-105894737 TCTCAGAAACCCTTTGAGGAAGG - Intronic
1196006571 X:110843496-110843518 TTACAACAACCCTATGAGGAAGG - Intergenic
1196794570 X:119491792-119491814 TCACAGATACCCAATGAGAAAGG - Intergenic
1196942478 X:120790988-120791010 TTCCAGAAACCCAAGGCGGGTGG - Intergenic
1197421733 X:126243986-126244008 TGGCAGAAAACAAATGAGGATGG - Intergenic
1197497828 X:127207659-127207681 TGGGAGAAACCCGATGAGGCTGG - Intergenic
1199673875 X:150168310-150168332 TTGCAACAACCCTATGAGGTAGG - Intergenic
1200927287 Y:8665930-8665952 TTGGAGTACCCCAATGAGCAAGG + Intergenic
1201773673 Y:17642476-17642498 TTACACAAACCCAACAAGGAAGG - Intergenic
1201827883 Y:18263509-18263531 TTACACAAACCCAACAAGGAAGG + Intergenic
1201931719 Y:19357385-19357407 TAGCAGAAAAACAATGAGTATGG + Intergenic