ID: 1121661845

View in Genome Browser
Species Human (GRCh38)
Location 14:95640846-95640868
Sequence CAGGGTCACCTCACTGAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121661838_1121661845 -4 Left 1121661838 14:95640827-95640849 CCACACTAAAGGGCTTCCCCAGG No data
Right 1121661845 14:95640846-95640868 CAGGGTCACCTCACTGAGCAGGG No data
1121661832_1121661845 8 Left 1121661832 14:95640815-95640837 CCCCCAAGGTGGCCACACTAAAG No data
Right 1121661845 14:95640846-95640868 CAGGGTCACCTCACTGAGCAGGG No data
1121661833_1121661845 7 Left 1121661833 14:95640816-95640838 CCCCAAGGTGGCCACACTAAAGG No data
Right 1121661845 14:95640846-95640868 CAGGGTCACCTCACTGAGCAGGG No data
1121661835_1121661845 6 Left 1121661835 14:95640817-95640839 CCCAAGGTGGCCACACTAAAGGG No data
Right 1121661845 14:95640846-95640868 CAGGGTCACCTCACTGAGCAGGG No data
1121661837_1121661845 5 Left 1121661837 14:95640818-95640840 CCAAGGTGGCCACACTAAAGGGC No data
Right 1121661845 14:95640846-95640868 CAGGGTCACCTCACTGAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121661845 Original CRISPR CAGGGTCACCTCACTGAGCA GGG Intergenic
No off target data available for this crispr