ID: 1121662702

View in Genome Browser
Species Human (GRCh38)
Location 14:95647234-95647256
Sequence GTGGAGGAGTAGAAGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121662696_1121662702 -4 Left 1121662696 14:95647215-95647237 CCTAGATGAGGATGCTGGAGTGG No data
Right 1121662702 14:95647234-95647256 GTGGAGGAGTAGAAGGAGGAGGG No data
1121662694_1121662702 3 Left 1121662694 14:95647208-95647230 CCAGGGGCCTAGATGAGGATGCT No data
Right 1121662702 14:95647234-95647256 GTGGAGGAGTAGAAGGAGGAGGG No data
1121662690_1121662702 9 Left 1121662690 14:95647202-95647224 CCTGCCCCAGGGGCCTAGATGAG No data
Right 1121662702 14:95647234-95647256 GTGGAGGAGTAGAAGGAGGAGGG No data
1121662693_1121662702 4 Left 1121662693 14:95647207-95647229 CCCAGGGGCCTAGATGAGGATGC No data
Right 1121662702 14:95647234-95647256 GTGGAGGAGTAGAAGGAGGAGGG No data
1121662692_1121662702 5 Left 1121662692 14:95647206-95647228 CCCCAGGGGCCTAGATGAGGATG No data
Right 1121662702 14:95647234-95647256 GTGGAGGAGTAGAAGGAGGAGGG No data
1121662686_1121662702 21 Left 1121662686 14:95647190-95647212 CCAGTTGGGAGACCTGCCCCAGG No data
Right 1121662702 14:95647234-95647256 GTGGAGGAGTAGAAGGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121662702 Original CRISPR GTGGAGGAGTAGAAGGAGGA GGG Intergenic
No off target data available for this crispr