ID: 1121666198

View in Genome Browser
Species Human (GRCh38)
Location 14:95674329-95674351
Sequence TGATGGTCAATATAGTATGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121666198_1121666206 17 Left 1121666198 14:95674329-95674351 CCCACATACTATATTGACCATCA No data
Right 1121666206 14:95674369-95674391 GCAGGCTTGTTTCTAAGGATGGG No data
1121666198_1121666201 -9 Left 1121666198 14:95674329-95674351 CCCACATACTATATTGACCATCA No data
Right 1121666201 14:95674343-95674365 TGACCATCATGAAAAAATGGTGG No data
1121666198_1121666205 16 Left 1121666198 14:95674329-95674351 CCCACATACTATATTGACCATCA No data
Right 1121666205 14:95674368-95674390 AGCAGGCTTGTTTCTAAGGATGG No data
1121666198_1121666208 21 Left 1121666198 14:95674329-95674351 CCCACATACTATATTGACCATCA No data
Right 1121666208 14:95674373-95674395 GCTTGTTTCTAAGGATGGGAGGG No data
1121666198_1121666204 12 Left 1121666198 14:95674329-95674351 CCCACATACTATATTGACCATCA No data
Right 1121666204 14:95674364-95674386 GGTGAGCAGGCTTGTTTCTAAGG No data
1121666198_1121666207 20 Left 1121666198 14:95674329-95674351 CCCACATACTATATTGACCATCA No data
Right 1121666207 14:95674372-95674394 GGCTTGTTTCTAAGGATGGGAGG No data
1121666198_1121666203 -1 Left 1121666198 14:95674329-95674351 CCCACATACTATATTGACCATCA No data
Right 1121666203 14:95674351-95674373 ATGAAAAAATGGTGGTGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121666198 Original CRISPR TGATGGTCAATATAGTATGT GGG (reversed) Intergenic