ID: 1121666202

View in Genome Browser
Species Human (GRCh38)
Location 14:95674346-95674368
Sequence TCACCACCATTTTTTCATGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121666202_1121666206 0 Left 1121666202 14:95674346-95674368 CCATCATGAAAAAATGGTGGTGA No data
Right 1121666206 14:95674369-95674391 GCAGGCTTGTTTCTAAGGATGGG No data
1121666202_1121666205 -1 Left 1121666202 14:95674346-95674368 CCATCATGAAAAAATGGTGGTGA No data
Right 1121666205 14:95674368-95674390 AGCAGGCTTGTTTCTAAGGATGG No data
1121666202_1121666204 -5 Left 1121666202 14:95674346-95674368 CCATCATGAAAAAATGGTGGTGA No data
Right 1121666204 14:95674364-95674386 GGTGAGCAGGCTTGTTTCTAAGG No data
1121666202_1121666207 3 Left 1121666202 14:95674346-95674368 CCATCATGAAAAAATGGTGGTGA No data
Right 1121666207 14:95674372-95674394 GGCTTGTTTCTAAGGATGGGAGG No data
1121666202_1121666208 4 Left 1121666202 14:95674346-95674368 CCATCATGAAAAAATGGTGGTGA No data
Right 1121666208 14:95674373-95674395 GCTTGTTTCTAAGGATGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121666202 Original CRISPR TCACCACCATTTTTTCATGA TGG (reversed) Intergenic