ID: 1121666207

View in Genome Browser
Species Human (GRCh38)
Location 14:95674372-95674394
Sequence GGCTTGTTTCTAAGGATGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121666198_1121666207 20 Left 1121666198 14:95674329-95674351 CCCACATACTATATTGACCATCA No data
Right 1121666207 14:95674372-95674394 GGCTTGTTTCTAAGGATGGGAGG No data
1121666202_1121666207 3 Left 1121666202 14:95674346-95674368 CCATCATGAAAAAATGGTGGTGA No data
Right 1121666207 14:95674372-95674394 GGCTTGTTTCTAAGGATGGGAGG No data
1121666199_1121666207 19 Left 1121666199 14:95674330-95674352 CCACATACTATATTGACCATCAT No data
Right 1121666207 14:95674372-95674394 GGCTTGTTTCTAAGGATGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121666207 Original CRISPR GGCTTGTTTCTAAGGATGGG AGG Intergenic